ID: 1186577699

View in Genome Browser
Species Human (GRCh38)
Location X:10784484-10784506
Sequence CAGTCAGACTGGAGTGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4750
Summary {0: 2, 1: 8, 2: 156, 3: 1542, 4: 3042}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186577699 Original CRISPR CAGTCAGACTGGAGTGCAGT GGG Intronic
Too many off-targets to display for this crispr