ID: 1186579212

View in Genome Browser
Species Human (GRCh38)
Location X:10799261-10799283
Sequence CAAGCAAATAATTGACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 340}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186579210_1186579212 -8 Left 1186579210 X:10799246-10799268 CCGTTTTTTTCACCTCAAGCAAA 0: 1
1: 0
2: 4
3: 49
4: 506
Right 1186579212 X:10799261-10799283 CAAGCAAATAATTGACAAGCAGG 0: 1
1: 0
2: 3
3: 36
4: 340
1186579209_1186579212 -1 Left 1186579209 X:10799239-10799261 CCTTTTTCCGTTTTTTTCACCTC 0: 1
1: 0
2: 4
3: 50
4: 585
Right 1186579212 X:10799261-10799283 CAAGCAAATAATTGACAAGCAGG 0: 1
1: 0
2: 3
3: 36
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186579212 Original CRISPR CAAGCAAATAATTGACAAGC AGG Intronic
904357532 1:29950387-29950409 CAAGAAAATAAATGACGAGAAGG + Intergenic
904854112 1:33483074-33483096 GAAAGAAATAATTGATAAGCTGG - Intronic
905288349 1:36902679-36902701 GAAAGAAATAATTGATAAGCTGG + Intronic
905327240 1:37162921-37162943 CAAACAAAAAATAGACAAACTGG - Intergenic
905426557 1:37890076-37890098 CAATCATGTAATTGACAAGCCGG + Intronic
906951569 1:50338487-50338509 GAAAGAAATAATTGACAGGCTGG - Intergenic
907170050 1:52454697-52454719 GAAAGAAATAATTGACAAGATGG + Intronic
908005637 1:59724975-59724997 CATGAAAAAAATTGATAAGCTGG - Intronic
908031728 1:60007431-60007453 CAAGAAAATGAATGACAAGATGG - Intronic
908157489 1:61369314-61369336 CAAGCAAATAATTTACTTGGAGG + Intronic
909087800 1:71187993-71188015 CAAGGAAATGGTTGAAAAGCCGG - Intergenic
909245782 1:73281294-73281316 GAAAGAAATAATTGACAATCTGG - Intergenic
910084772 1:83386957-83386979 AAAAGAAATAATTGATAAGCTGG + Intergenic
910393306 1:86766523-86766545 AAAACAAAAAATTGACAAGTGGG - Intergenic
910753853 1:90664801-90664823 AAAGAAAATAATTGCCAAGCTGG - Intergenic
911692902 1:100855618-100855640 CAAGACAAAAATTGACAAGTGGG - Intergenic
911892653 1:103392140-103392162 AAAGCAAAAAATTGACAAATGGG - Intergenic
912040023 1:105378230-105378252 CAAAACAATAATTGACAAGTGGG - Intergenic
912945695 1:114082233-114082255 CAGGCACATAATTCAGAAGCAGG - Intergenic
914698782 1:150111363-150111385 ACAGCAAATAGTTGACTAGCTGG + Intronic
915010489 1:152681167-152681189 AAACAAAATAATTGACAATCTGG + Intergenic
916276167 1:162995974-162995996 AAAGAAAAAAATTGATAAGCTGG + Intergenic
916637293 1:166686546-166686568 AAAACAAAAAATTGACAAGTGGG - Intergenic
917591960 1:176485458-176485480 CAAGCAAATAATTGAAAGAGTGG - Intronic
919326809 1:196118311-196118333 CACACACATAATTGACAAGTGGG + Intergenic
919995755 1:202748383-202748405 CAAGAAAATAATTAACAAACTGG + Intronic
921804541 1:219438479-219438501 CATGCAAATAACTAACAAGAAGG + Intergenic
922181410 1:223236360-223236382 GAAGGAAATAATTGATAAGTTGG - Intronic
922704829 1:227784767-227784789 GAAACAATAAATTGACAAGCTGG + Intergenic
924020879 1:239780620-239780642 GAAAGAAATAATTGATAAGCGGG - Intronic
1064182213 10:13127843-13127865 GAAGCAAACCATTGCCAAGCAGG + Exonic
1065367786 10:24952450-24952472 CAAGCATTTAATCTACAAGCAGG + Intronic
1065526414 10:26625976-26625998 GAAATAAATAATTGATAAGCTGG - Intergenic
1065556958 10:26925589-26925611 GGAACAAATAATTGATAAGCTGG + Intergenic
1067857847 10:49812099-49812121 AAAGGAAATAATTGATAAACTGG - Intergenic
1069247413 10:66223654-66223676 CAAGCCAATAATTGACAGGCTGG - Intronic
1069358854 10:67619166-67619188 AAAGAAAATAATTGTGAAGCTGG + Intronic
1070538705 10:77400414-77400436 CATGCAAATGTTTAACAAGCAGG + Intronic
1070996839 10:80791753-80791775 GAAAGAAATAATTGATAAGCTGG - Intergenic
1071024389 10:81094763-81094785 GAAATAAATAATTGATAAGCTGG - Intergenic
1072059325 10:91794229-91794251 CAAGCAAAAAATGGACAAATGGG + Intergenic
1072437662 10:95428702-95428724 CAGGCAAATAATCAACAACCTGG + Intronic
1072510690 10:96121343-96121365 CAAGCAATGAATTAATAAGCAGG - Intergenic
1074207946 10:111300789-111300811 CAGGGAAATAATTGAGAAACTGG - Intergenic
1074341438 10:112634284-112634306 CAACCAAAAAATGGACAATCAGG - Intronic
1074389894 10:113048292-113048314 CAAGACAAGAAATGACAAGCAGG - Intronic
1076047896 10:127309449-127309471 AAAGCAAAAAATTGACAACCGGG - Intronic
1076076948 10:127541195-127541217 TAAGGAAACAAGTGACAAGCTGG - Intergenic
1076085351 10:127623789-127623811 CAAGCAAATAATTGTCTTACAGG - Intergenic
1076575810 10:131466411-131466433 GAAGGAAATAATTGATCAGCTGG - Intergenic
1079787486 11:24692347-24692369 AAAACAAATAAGTCACAAGCAGG + Intronic
1079841246 11:25402384-25402406 CAAACAAATATTTGACAATATGG + Intergenic
1080423187 11:32131278-32131300 AAAACAAAAAATTGACAAGTGGG + Intergenic
1080841581 11:35988574-35988596 CAAAAAAAAAATTGACAAGTGGG - Intronic
1081144138 11:39540504-39540526 CTAGAAAATAATTAACAAACTGG - Intergenic
1082109003 11:48252464-48252486 CAACCAAAAAATTGACAAGTGGG - Intergenic
1082189350 11:49223996-49224018 CACAAAAATAATTGTCAAGCAGG + Intergenic
1082631925 11:55553592-55553614 TAAGCAAATAACAGACAATCTGG - Intergenic
1082739076 11:56890417-56890439 CAGGCAAAGAAGTGAGAAGCTGG + Intergenic
1083379933 11:62258310-62258332 AAAACAAAAAATTGACAAGTGGG + Intergenic
1086487636 11:87325550-87325572 CAAGCAGAGAATGGACAAGGTGG - Intergenic
1086677174 11:89622500-89622522 CACAAAAATAATTGTCAAGCAGG - Intergenic
1086772598 11:90786803-90786825 AAAGCAAATAATTTACAAAATGG + Intergenic
1088921115 11:114260400-114260422 CCAGCAAATTCTGGACAAGCAGG - Intronic
1092319418 12:7455824-7455846 CCAGCAAATAATTAACAAAATGG + Intronic
1092738540 12:11606854-11606876 CAAACAAATAATAAATAAGCTGG - Intergenic
1092751201 12:11720708-11720730 AAAACAAAAAATTGACAAGTGGG + Intronic
1093936410 12:25005870-25005892 CAAAACAAAAATTGACAAGCGGG + Intergenic
1094453182 12:30603785-30603807 CAACCAAAAAATTAAAAAGCAGG + Intergenic
1095542573 12:43328106-43328128 AAAGCAAAAAATTGACAAACGGG - Intergenic
1095735525 12:45552559-45552581 CATGTAAATATTTTACAAGCAGG + Intergenic
1097323531 12:58251083-58251105 CAAACAAATTAATGACAAGGAGG - Intergenic
1097455159 12:59791272-59791294 GAAAGAAAGAATTGACAAGCTGG - Intergenic
1097860311 12:64512319-64512341 AAAGCAAATAAATGATCAGCCGG + Intergenic
1097943555 12:65340115-65340137 CAAGAAAATAGATGACAAGATGG + Intronic
1098596528 12:72278954-72278976 AAAGCAAAAAATAGACAAACGGG - Intronic
1099064139 12:77952238-77952260 AAAATAAATAATTGATAAGCTGG - Intronic
1100173637 12:92005714-92005736 CAAAAAAATTATGGACAAGCCGG + Intronic
1101896283 12:108759452-108759474 CAAAAAAATAACTGACAATCTGG + Intergenic
1103143184 12:118570240-118570262 CAAGAAAATAGATGACAAGATGG - Intergenic
1104710913 12:130985370-130985392 GAAAGAAATAATTGACAAGCTGG - Intronic
1105248092 13:18670870-18670892 CAAGCAAACAATTGAAATGCAGG - Intergenic
1108001957 13:45911911-45911933 CAAGGAAATCATGGCCAAGCAGG - Intergenic
1110605844 13:77431361-77431383 TAAGAAAATAAATGACAAGATGG - Intergenic
1111271303 13:85890916-85890938 GAAAGAAATAATTGATAAGCAGG - Intergenic
1111532734 13:89560622-89560644 AAAGCAAAAAATTGACAAATGGG + Intergenic
1112259011 13:97861307-97861329 AAAGAAAATAATTGTCAATCTGG + Intergenic
1114282463 14:21205740-21205762 GAAGCAACTGATTGACAAGATGG + Intergenic
1114934825 14:27521168-27521190 TAAGCAGATAATTTACAAGTAGG - Intergenic
1115200993 14:30854003-30854025 CAAAAAAATAATTTACAAGCAGG - Intergenic
1115470029 14:33758935-33758957 CATGCAATTAATTCAAAAGCTGG - Intronic
1115633332 14:35267183-35267205 TTAGCAAATACTTGACAAACAGG + Intronic
1115862751 14:37707125-37707147 CATGCAAATAAATGAAAAACAGG - Intronic
1116508234 14:45712078-45712100 CAAAAAAATAATTCACAAACCGG - Intergenic
1117505028 14:56393437-56393459 GAAAGAAATAATTGATAAGCTGG + Intergenic
1117607648 14:57446827-57446849 AAAAGAAATAATTGATAAGCTGG - Intergenic
1118097265 14:62551335-62551357 AAAGCAAAAAATGGACAAACAGG + Intergenic
1119376131 14:74194846-74194868 CAAAAAAATAGTTGACAGGCTGG + Intronic
1119637453 14:76288067-76288089 CCAGAAAATAACTGACAAGATGG - Intergenic
1122390355 14:101376741-101376763 AAAGCAAATAACTTACAAGGTGG + Intergenic
1124790217 15:32719310-32719332 CAGGCAAATAAACGCCAAGCTGG - Intronic
1125075899 15:35617949-35617971 CAAGCAAATAATTTAAAAAATGG + Intergenic
1125098033 15:35877042-35877064 CATGCAAATATTTGCAAAGCAGG - Intergenic
1125764566 15:42125170-42125192 GAAAGAAATAATTGATAAGCTGG - Intergenic
1128701666 15:69809155-69809177 CAAGCAATTCTTTGACAAGTTGG - Intergenic
1128850522 15:70950770-70950792 AAAACAAAAAATTGACAAGTAGG - Intronic
1129996908 15:80014578-80014600 GAAATAAATAATTGATAAGCTGG - Intergenic
1132020441 15:98356848-98356870 GAAAGAAATAATTGATAAGCTGG + Intergenic
1132255900 15:100375189-100375211 CAAAGAAATAATTGATAAGCTGG - Intergenic
1134836041 16:17361628-17361650 CAAGGAAATAAGTGACCATCAGG + Intronic
1135236738 16:20763818-20763840 AAAGCAAATTATTAACAAGAAGG - Exonic
1135522603 16:23189006-23189028 CAAGTAAATAACTGCCAACCAGG - Intronic
1136772169 16:32849896-32849918 AAAGCAAATAATAGACAAATGGG + Intergenic
1136898442 16:34011625-34011647 AAAGCAAATAATAGACAAATGGG - Intergenic
1137443652 16:48518125-48518147 GAAATAAATAATTGATAAGCTGG + Intergenic
1138355721 16:56378580-56378602 AAAGAAAATAATTGATAAGCTGG + Intronic
1138591833 16:58003958-58003980 GAAAGAAATAATTGATAAGCTGG - Intronic
1138782395 16:59805068-59805090 CAAGCAAGCAAGTGACCAGCAGG + Intergenic
1138811459 16:60155296-60155318 AAAAGAAATAATTGATAAGCTGG + Intergenic
1140203940 16:72918205-72918227 CAAGCAAATAAGTCAAAAGCAGG + Intronic
1140278300 16:73530849-73530871 CCAGAAAATACTTGACAACCAGG + Intergenic
1142015923 16:87747349-87747371 CAAGCAAATCAGTAACAAGCGGG + Intronic
1142098295 16:88257521-88257543 GAAAGAAATAATTGATAAGCTGG - Intergenic
1203074591 16_KI270728v1_random:1111985-1112007 AAAGCAAATAATAGACAAATGGG + Intergenic
1144048289 17:11473171-11473193 GAAAGAAATAATTGACAAGCTGG - Intronic
1144941169 17:18942284-18942306 AAAGGAAAGAATTGATAAGCTGG + Intergenic
1148691725 17:49531669-49531691 GAAAGAAATAATTGATAAGCTGG - Intergenic
1150588039 17:66535980-66536002 CAGGCAAATAATTAATAATCAGG - Intronic
1151124748 17:71832624-71832646 CAAGCTACTAATTTACAAACTGG + Intergenic
1154010152 18:10567463-10567485 AAAGCAATTACTTGACATGCAGG + Intergenic
1154440762 18:14388261-14388283 CAAGCAAACAATTGAAATGCAGG + Intergenic
1154944701 18:21149970-21149992 AAAGGAAATAATTGACAAAATGG - Intergenic
1155265607 18:24090069-24090091 TAAGTAAATAATTGACATGCAGG + Intronic
1155900551 18:31383880-31383902 AAAACAAATAATTGAAAAGCAGG - Intronic
1159373209 18:67556310-67556332 AAAAGAAATAATTGATAAGCTGG - Intergenic
1159879676 18:73846464-73846486 CAAGCAAACAAAAAACAAGCAGG + Intergenic
1166187499 19:41150904-41150926 AAAGGAAAAAATTGACAAACTGG + Intergenic
924971233 2:128823-128845 TAGGCAAATAATTTACAAGAAGG - Intergenic
928001500 2:27526738-27526760 CAACAAAATAAGTAACAAGCTGG + Intergenic
928168200 2:28986207-28986229 CAATGAGATAAGTGACAAGCAGG - Intronic
929267586 2:39936475-39936497 CAACAAAAAAATTGACAAGTGGG + Intergenic
929409582 2:41682779-41682801 GAAAGAAATAATTGATAAGCTGG - Intergenic
930186287 2:48415335-48415357 GGAGCAGATAATTGGCAAGCTGG + Intergenic
931763766 2:65436959-65436981 CCAGGAAATAATTGACAGGCTGG + Intergenic
932636949 2:73397984-73398006 GAAAGAAATAATTGATAAGCTGG - Intronic
935748098 2:106206916-106206938 GAAGCTTATCATTGACAAGCAGG - Intergenic
936705110 2:115063398-115063420 AAAGCAAAAAATTGACAAAAGGG - Intronic
936851741 2:116907535-116907557 CAAGTAAATAAGTGACAAGTAGG - Intergenic
936973176 2:118193988-118194010 GAAGGAAGTAATTGATAAGCTGG + Intergenic
937837427 2:126486491-126486513 CAACAAAATAAGTGACAAGTAGG - Intergenic
938246064 2:129779004-129779026 CAGGCATATAATTAGCAAGCGGG + Intergenic
938805223 2:134801029-134801051 AAAGCTAAGAATTCACAAGCAGG - Intergenic
939102770 2:137914632-137914654 CAAGCAAACAATTGAAATACAGG - Intergenic
940044779 2:149398274-149398296 CAAGCAAATAATAGAGAAAAAGG - Intronic
940526102 2:154815998-154816020 CAAACAAATAATTGGCTTGCAGG - Intronic
941671071 2:168293234-168293256 CAAGCAACAAGTAGACAAGCTGG - Intergenic
942906857 2:181193360-181193382 GAAAGAAATAATTGATAAGCTGG + Intergenic
943624551 2:190183861-190183883 AAAGCAAATGATTTTCAAGCTGG - Intronic
944070200 2:195658582-195658604 AAAGCAAGTAATGGAAAAGCTGG + Intronic
944360924 2:198855476-198855498 CAACAAAAAAATTGACAAGTGGG + Intergenic
944842912 2:203641618-203641640 AAAGCAAAAAATGGACAAACGGG - Intergenic
945432545 2:209781011-209781033 CAAGGAAAGGACTGACAAGCTGG - Intronic
946663187 2:222022529-222022551 AAAACAAAAAATTGACAAACGGG + Intergenic
946770172 2:223080735-223080757 AAAGCAAAAAATTGACAAATGGG + Intronic
947030687 2:225789822-225789844 TAAGAAAATAATTGACAATTGGG + Intergenic
947495113 2:230629687-230629709 AAAAGAAATAATTGATAAGCTGG + Intergenic
1169120010 20:3089894-3089916 CAAGCTAATAATTCCCAAACTGG + Intergenic
1169819168 20:9689888-9689910 GAGGCACATAATTGCCAAGCAGG + Intronic
1170056734 20:12213482-12213504 TAAGCCAATAAGTGACAATCTGG + Intergenic
1171022846 20:21602474-21602496 CAAGAATATAATGAACAAGCGGG - Intergenic
1171140501 20:22736951-22736973 CAAGCAAATAAAAAAAAAGCAGG + Intergenic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1173935717 20:46861403-46861425 TAAGCAAATAATTGAGAAAATGG - Intergenic
1177439161 21:21097783-21097805 CAAGAAAGCAATTGATAAGCTGG + Intronic
1177591681 21:23178635-23178657 CCAGTAAATAATTTAAAAGCAGG - Intergenic
1178738103 21:35171088-35171110 CTAGGAAATAATAGACAAACAGG - Intronic
1182200995 22:28569690-28569712 AAAGCAAAAAATTGGCAAGTGGG + Intronic
1183964956 22:41436082-41436104 CAACCAAATAAATCACAGGCCGG + Exonic
949663472 3:6309060-6309082 CAAAACAAAAATTGACAAGCAGG + Intergenic
952426181 3:33176612-33176634 GAAAGAAATAATTGATAAGCTGG - Intronic
952479117 3:33742133-33742155 GAAATAAATAATTGATAAGCTGG - Intergenic
953243813 3:41172868-41172890 TAAGCAAATAATTGTCTAGGTGG - Intergenic
953873914 3:46653519-46653541 GAAATAAATAATTGATAAGCTGG + Intergenic
954879993 3:53828380-53828402 GAAAGAAATAATTGATAAGCTGG + Intronic
955169953 3:56553682-56553704 CAAAGAAAGAATTGATAAGCTGG - Intergenic
957120919 3:76091076-76091098 GAAGAAAATAATTGATAACCTGG + Intronic
957905971 3:86555430-86555452 GAATTAAATAATTCACAAGCAGG + Intergenic
958769864 3:98413291-98413313 AAAGCAAAAAATTGACAAATGGG + Intergenic
959265779 3:104136510-104136532 AAAGCAAATATATGACACGCAGG + Intergenic
959431694 3:106261848-106261870 CAAACCAAAAATTGACAAGCAGG + Intergenic
959646400 3:108708155-108708177 GAAAGAAATAATTGATAAGCTGG - Intergenic
960220594 3:115103828-115103850 GAAAGAAATAATTGATAAGCTGG + Intronic
960236104 3:115284363-115284385 CAAGCAAATAAATCACAATGAGG - Intergenic
960265176 3:115613337-115613359 AAAGCAAAAAATTGACAAATGGG + Intergenic
960745637 3:120885121-120885143 CAAACATATTAATGACAAGCTGG + Intergenic
960751291 3:120957577-120957599 TAAGAAAAAAATTGAAAAGCAGG - Intronic
961685252 3:128625492-128625514 CAAGGACACAAATGACAAGCAGG + Intronic
962107496 3:132406817-132406839 AAAGCAAATAAATGACAAAGGGG - Intergenic
962925459 3:139989119-139989141 CAGGCAAAAAATGGTCAAGCTGG + Intronic
963768058 3:149358790-149358812 AAAAGAAATAATTGACAAGTTGG - Intergenic
964466184 3:156996058-156996080 CCAACAAATAATTGACAGACTGG - Intronic
965289276 3:166857235-166857257 GAAAGAAAGAATTGACAAGCTGG + Intergenic
965581823 3:170276767-170276789 AAAGCCAAAAATTGACAAGTGGG + Intronic
967119675 3:186371614-186371636 CTAGTAAATATTTGACAATCAGG - Intergenic
967413594 3:189192959-189192981 AAAGGAAATTATTGACAACCAGG - Intronic
967911664 3:194547420-194547442 AAAGAAAAAAATTGATAAGCTGG - Intergenic
969109496 4:4834308-4834330 GAAGTAAATAATTGATAAGCTGG + Intergenic
970684202 4:18547340-18547362 CAAAAAAATCATTGACAAGATGG + Intergenic
970969767 4:21968442-21968464 AAAGCAAAAAATTGACAAATGGG + Intergenic
971090640 4:23340988-23341010 GAAAGAAATAATTGATAAGCTGG + Intergenic
971147603 4:23995789-23995811 CAAGCAGGTAAATGACAATCAGG - Intergenic
971510746 4:27420242-27420264 CAAGCATATATATGGCAAGCAGG - Intergenic
971821624 4:31564342-31564364 GAAATAAATAATTAACAAGCTGG + Intergenic
972085884 4:35215094-35215116 GAAGAAATTAATTGATAAGCTGG + Intergenic
972180131 4:36454441-36454463 AAAGCAAAAAATAGACAAGTGGG - Intergenic
972448715 4:39174139-39174161 AAAAGAAATAATTGATAAGCTGG - Intergenic
972849360 4:43030036-43030058 AAACCAAATAATTCAGAAGCTGG - Intronic
973876261 4:55222554-55222576 CAGTCAAATAAATGAGAAGCTGG - Intergenic
974333017 4:60504678-60504700 CAGTCAAATAAATGACAAGAGGG + Intergenic
974514514 4:62891668-62891690 CCTACAAATAATTGATAAGCTGG - Intergenic
974781363 4:66557781-66557803 AAAGCAAATAAATGACACGCTGG + Intergenic
974783962 4:66593064-66593086 CAAGCAAATTATTGGAAAGGAGG + Intergenic
974927434 4:68317594-68317616 AAAGGAAATAATTAAAAAGCAGG + Intronic
975390229 4:73807602-73807624 AAAACAAAAAATTGACAAGTGGG + Intergenic
976113798 4:81705036-81705058 AAAGCAACTGATTGACAAGATGG + Intronic
978129438 4:105177259-105177281 GAAGGAAATGATTGACAAGCTGG + Intronic
978346057 4:107771024-107771046 GAAAGAAATAATTGATAAGCTGG + Intergenic
978663754 4:111157568-111157590 CAAGGTAATTATTGATAAGCAGG - Intergenic
978931180 4:114314265-114314287 AAAACAAAAAATTGACAAGTGGG - Intergenic
978977496 4:114896317-114896339 AAAGCAAATAATTTAACAGCAGG - Intronic
979015503 4:115427410-115427432 CATCCAGATAATTAACAAGCAGG - Intergenic
979719106 4:123878200-123878222 CAACAAAAAAATTGACAAGTGGG + Intergenic
980164007 4:129202430-129202452 CTAACAAATAAATAACAAGCTGG + Intergenic
980695018 4:136343177-136343199 CAAAAACAAAATTGACAAGCGGG + Intergenic
981115640 4:140987739-140987761 CAACAAAAAAATTGACAAGTGGG + Intronic
981203120 4:142006751-142006773 AAAACAAAAAATTGACAAGTGGG - Intergenic
981389127 4:144167745-144167767 CAAGAAAAAAATTGACCAGTGGG + Intergenic
982978472 4:162099552-162099574 GAAAGAAATAATTGATAAGCTGG + Intronic
983789078 4:171772416-171772438 CAAACAAATTATTGCCAACCAGG - Intergenic
983830242 4:172318033-172318055 AAAGCAATTAAATGATAAGCAGG + Intronic
985007829 4:185551794-185551816 CAATCAAATAAGTGAGAAGCTGG - Intergenic
985375418 4:189332464-189332486 TTAGCAAAAAATTGACAAGTGGG + Intergenic
986660938 5:10059545-10059567 AAAGCAAACAAAAGACAAGCAGG + Intergenic
987909926 5:24128402-24128424 CAAGGAAATACTTAACAAGAAGG - Intronic
988474687 5:31573394-31573416 CAAACAAATAAGTTACAAGGAGG + Intergenic
988720561 5:33874056-33874078 GAAAGAAATAATTGATAAGCTGG + Intronic
990326650 5:54683124-54683146 GAAATAAATAATTGATAAGCTGG - Intergenic
990656404 5:57961561-57961583 AAAGCAAAAAATTGACAAATGGG - Intergenic
992263970 5:74999078-74999100 GAAAGAAATAATTGATAAGCTGG - Intergenic
992601023 5:78399799-78399821 GAAAGAAATAATTGAAAAGCTGG - Intronic
993963226 5:94327632-94327654 CAGGCAAATATTTGAAAAGAAGG - Intronic
994569440 5:101496415-101496437 GAAAGAAATAATTGATAAGCTGG + Intergenic
995044689 5:107632475-107632497 AAAGTAAATAGTTGACAAGATGG - Intronic
995168114 5:109071756-109071778 AAAACATATAATTGACAATCTGG + Intronic
995427040 5:112036790-112036812 CAACAAAAAAATTGACAAGTGGG - Intergenic
996217591 5:120888178-120888200 AAAAGAAATAATTGACAAGCTGG - Intergenic
997117486 5:131141110-131141132 GAAAGAAATAATTGATAAGCTGG + Intergenic
998688936 5:144565078-144565100 CCAGAAAATAATTGACAAAATGG - Intergenic
999549424 5:152669899-152669921 TAGGCAAATAATTGTCAAACAGG + Intergenic
1000063446 5:157675777-157675799 AAAGGAAAAAATTGACAAGATGG - Intronic
1000261407 5:159591942-159591964 TAAGCCAATAAATGGCAAGCGGG + Intergenic
1003904568 6:10687691-10687713 CAAGCAATTAATTGCCTAGCAGG - Intronic
1004611741 6:17247983-17248005 GAAAGAAATAATTGATAAGCTGG - Intergenic
1006568143 6:34977516-34977538 CAAGCAAATAATTAAAATACAGG - Intronic
1007243691 6:40444848-40444870 GAAGCAAAAAATTGCAAAGCAGG - Intronic
1008235469 6:49042053-49042075 CCATGAGATAATTGACAAGCTGG - Intergenic
1009058040 6:58362132-58362154 AAAGAAAAAAATTGATAAGCTGG + Intergenic
1009161739 6:60291107-60291129 CAGGAAGATAATTGACAGGCAGG + Intergenic
1009232788 6:61084968-61084990 AAAGAAAAAAATTGATAAGCTGG - Intergenic
1009289015 6:61861224-61861246 AAAGCAAATAATTGACCAGTGGG - Intronic
1009701082 6:67181944-67181966 TAAGCAAATAATTGAGAAGGTGG - Intergenic
1010708933 6:79149785-79149807 CAATGAAATAATTGACAGACAGG + Intergenic
1011105613 6:83776949-83776971 CAAAGAAATAGTTGATAAGCTGG + Intergenic
1011432294 6:87300977-87300999 CAAGAAAATAAATGACAAGATGG + Intronic
1011800540 6:91009802-91009824 AAAACCAAAAATTGACAAGCAGG - Intergenic
1012569977 6:100712240-100712262 AAAGGAAATAATTGACAAGCTGG + Intronic
1014219985 6:118790264-118790286 GAAGCCAAAAAGTGACAAGCTGG + Intergenic
1014355254 6:120400467-120400489 GAAGCAAAAAATTGACAAATGGG - Intergenic
1014897125 6:126915601-126915623 CAACCAAATTAGTGACAAGTAGG + Intergenic
1015317959 6:131838276-131838298 AAAGAAAATAATTGCCAAACTGG + Intronic
1016017481 6:139200791-139200813 CAAGAAAAATATTGACAAGATGG - Intergenic
1016137995 6:140570290-140570312 AAAACAAATTATTGATAAGCTGG - Intergenic
1018263984 6:162000661-162000683 GAAAGAAATAATTGATAAGCTGG - Intronic
1018496595 6:164353720-164353742 AAAACAAAAAATTGACAAGTGGG - Intergenic
1020582790 7:10026762-10026784 AAAGCAAAAAATTGACAAATGGG - Intergenic
1020909767 7:14114135-14114157 CAAGCAAAATAGTGACAAGACGG + Intergenic
1021506435 7:21390552-21390574 GAAAGAAATAATTGATAAGCTGG - Intergenic
1021892355 7:25198183-25198205 CATGCATAAAATTAACAAGCTGG + Intergenic
1022296324 7:29057508-29057530 GAAAGAAATAATTGAGAAGCTGG - Intronic
1022575541 7:31493475-31493497 CAAGCAAATAAATAAGAAGAGGG - Intergenic
1023561960 7:41484470-41484492 GAAAGAAATAATTGATAAGCTGG + Intergenic
1024830991 7:53456977-53456999 GATGGAAATAATTGATAAGCTGG + Intergenic
1026147986 7:67764477-67764499 CAAGTTAATAATTGATAAGTTGG + Intergenic
1027301591 7:76843070-76843092 AAAAGAAATAATTGATAAGCTGG + Intergenic
1027611403 7:80365833-80365855 CAACAAAAAAATTGACAAGTGGG + Intergenic
1027997075 7:85437879-85437901 CAATCAAACAACTGAAAAGCAGG - Intergenic
1028297028 7:89146432-89146454 AATGGATATAATTGACAAGCTGG + Intronic
1028551129 7:92067545-92067567 CAGGCAAACAAGTGACAAGTGGG - Intronic
1028668558 7:93374519-93374541 CACTCAAATATTTGCCAAGCTGG - Intergenic
1028699918 7:93765420-93765442 CAAACAAAAAATTGACAAGTGGG + Intronic
1030542454 7:110848040-110848062 GAAAGAAATAATTGATAAGCTGG + Intronic
1030877121 7:114827644-114827666 AAAAGAAATAATTGACAAGTTGG + Intergenic
1031480996 7:122278494-122278516 AAAACAAAAAATTGACAAGTGGG - Intergenic
1031924373 7:127624519-127624541 CATGGAAATAATTGATAAACTGG - Intergenic
1032178552 7:129654471-129654493 AAAGCAAAAAATCGATAAGCTGG - Intronic
1032533049 7:132637712-132637734 CAAGCAAATAACTGAAAATGAGG + Intronic
1037687390 8:21154403-21154425 GAAAGAAATAATTGATAAGCTGG + Intergenic
1037696097 8:21225459-21225481 CAAGGAAAGACTGGACAAGCAGG + Intergenic
1038323952 8:26557177-26557199 GAAAAAAATAATTGATAAGCTGG + Intronic
1038661695 8:29503061-29503083 CAAGCACATAAGTGACAAGAAGG - Intergenic
1039006485 8:33043692-33043714 CTAGAAAATAATTGACTACCTGG + Intergenic
1039782763 8:40803203-40803225 AAAAGAAAAAATTGACAAGCTGG + Intronic
1039924962 8:41921461-41921483 GAAAGAAATAATTGATAAGCTGG + Intergenic
1042089569 8:65144148-65144170 CAAACAAATAATTCACAATGTGG + Intergenic
1042292861 8:67188008-67188030 AAAAGAAATAATTGATAAGCCGG + Intronic
1043562372 8:81508927-81508949 GAAAGAAATAATTGATAAGCTGG + Intergenic
1043862422 8:85335263-85335285 CAAGCAAACATTTTTCAAGCAGG - Intronic
1044624646 8:94225351-94225373 CAAGCAAATAAATGAAAAGCAGG + Intergenic
1045095785 8:98796586-98796608 CAACCAAAAAACTGACAAGTGGG + Intronic
1045130914 8:99151382-99151404 AAAACAAAGAATTGATAAGCAGG - Intronic
1045284013 8:100774211-100774233 TAAGCGAATAAATGACAAACTGG - Intergenic
1045811765 8:106229671-106229693 GAAAGAAATAATTGATAAGCTGG - Intergenic
1046223543 8:111246658-111246680 CAAGAAAAAAATTGATAAGTAGG + Intergenic
1046574370 8:116007791-116007813 GAAGGAAATAATTGATAAGTTGG + Intergenic
1046884398 8:119347927-119347949 AAAAGAAATAATTGATAAGCTGG - Intergenic
1047081202 8:121462853-121462875 AAAGGAAATAATTGACAAAATGG + Intergenic
1047363230 8:124188693-124188715 AAAACCAAGAATTGACAAGCGGG - Intergenic
1048039884 8:130716988-130717010 CAAGCAGGTAAGTGGCAAGCTGG - Intergenic
1048405916 8:134120694-134120716 TAAGCACATATTTGAAAAGCAGG + Intergenic
1050217991 9:3350101-3350123 GGAACAAATAATTCACAAGCTGG + Intronic
1050784219 9:9379015-9379037 GAAAGAAATAATTGATAAGCTGG - Intronic
1051597168 9:18836440-18836462 AAAGCAAAAAATTGACAAGTTGG - Intronic
1052119716 9:24697442-24697464 AAAGCAAATAATGGACAAATGGG + Intergenic
1052185832 9:25593084-25593106 CAAACAATTAATAGACAAGCTGG - Intergenic
1052759330 9:32573473-32573495 CAAGCAAATAATTTTGAATCTGG - Intergenic
1052783747 9:32809460-32809482 GAAAGAAATAATTGATAAGCTGG + Intergenic
1053040953 9:34871450-34871472 GAAAGAAATAATTGATAAGCTGG - Intergenic
1057278365 9:93689759-93689781 AAATAAAAAAATTGACAAGCTGG + Intergenic
1057286784 9:93762835-93762857 GAAATAAATAATTGATAAGCTGG + Intergenic
1057508509 9:95657324-95657346 GAAAGAAATAATTGATAAGCTGG - Intergenic
1058020480 9:100081246-100081268 AATGCAAATAATGGAAAAGCTGG + Intronic
1059631391 9:116127153-116127175 AAAACAAAAAATTGACAAGTGGG - Intergenic
1059890411 9:118795899-118795921 AAAAGAAATAATTGACAAACTGG - Intergenic
1060066702 9:120508410-120508432 CAAACAAATAATTCATATGCTGG + Intronic
1060701971 9:125762164-125762186 CAAGAAAAAAAATGACAAGAAGG - Intronic
1186579212 X:10799261-10799283 CAAGCAAATAATTGACAAGCAGG + Intronic
1187601418 X:20836035-20836057 CAAACACAAAATTGGCAAGCGGG - Intergenic
1187872001 X:23772275-23772297 AAAGCAAAAAATAGACAAGTGGG + Intergenic
1188444376 X:30241467-30241489 AAAGAAAATAATTGATAATCTGG - Intergenic
1188741275 X:33785291-33785313 CATGGAAACAATTGACAACCTGG - Intergenic
1188947668 X:36327087-36327109 AAAACAAAAAATTGACAAGTGGG + Intronic
1190605038 X:52132521-52132543 TAAACAAAAAATTGACAAGTGGG + Intergenic
1191906307 X:66094457-66094479 CAAACAAACAATTGAAAAGGAGG + Intergenic
1192471083 X:71399234-71399256 AAAGAGAATAAATGACAAGCCGG - Intronic
1192596794 X:72418191-72418213 AAAACAAAAAATTGACAAGGTGG + Intronic
1192633713 X:72797624-72797646 CAAGCAAATAAATGAAGAGGAGG - Intronic
1192647997 X:72923177-72923199 CAAGCAAATAAATGAAGAGGAGG + Intronic
1192704935 X:73519349-73519371 CAAGCAAATATTTGATAAGGAGG - Intergenic
1193647212 X:84084219-84084241 AAAGCAAACAATTGACAAATGGG - Intronic
1193872743 X:86821691-86821713 CAAGCGAATCCTTGACAACCAGG - Intronic
1194029851 X:88799234-88799256 CAACAAAAAAATTGACAAGTGGG - Intergenic
1194552003 X:95312116-95312138 AAAGAAAATAATTGATAAACTGG - Intergenic
1194649931 X:96502329-96502351 AAAACAAAAAATTGACAAGTGGG - Intergenic
1195493308 X:105499369-105499391 GAAGCAAAAAATAGACAAGTGGG + Intronic
1195668212 X:107449414-107449436 TAAGCAAAAAATTGACAATTGGG - Intergenic
1196155640 X:112425942-112425964 GAAATAAATAATTGAGAAGCTGG - Intergenic
1196270608 X:113706189-113706211 AAATGAAATAATTGATAAGCTGG - Intergenic
1196306955 X:114114412-114114434 AAAGGAAATAATCTACAAGCTGG + Intergenic
1196576931 X:117329455-117329477 CAACAAAATAATTGACAAGTGGG + Intergenic
1196666138 X:118318788-118318810 CAAGGAACTAATTGACTAGTGGG - Intergenic
1196767271 X:119258501-119258523 AAAAGAAATAATTGATAAGCTGG + Intergenic
1196949725 X:120865240-120865262 GAAAAAAATAATTGATAAGCTGG - Intergenic
1197030743 X:121811257-121811279 GAAATAAATAATTGATAAGCTGG - Intergenic
1197096101 X:122597505-122597527 AAAGAAAAAATTTGACAAGCTGG + Intergenic
1197713279 X:129687492-129687514 CAAGCAAATACCTGACAGGAGGG - Intergenic
1197801340 X:130352922-130352944 AAAACAAAAAATTGACAAGCGGG - Intronic
1199418145 X:147610810-147610832 AAAGCAAAAAATAGACAAACAGG + Intergenic
1199559740 X:149150245-149150267 CAAGCATAAAATTGAGAATCTGG - Intergenic
1200336734 X:155358849-155358871 AAAGCAAAAAATTGACAAATGGG + Intergenic
1200349736 X:155482378-155482400 AAAGCAAAAAATTGACAAATGGG - Intergenic