ID: 1186584179

View in Genome Browser
Species Human (GRCh38)
Location X:10853948-10853970
Sequence TTCTATTTGCATGATGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186584179_1186584182 4 Left 1186584179 X:10853948-10853970 CCTTCCACATCATGCAAATAGAA No data
Right 1186584182 X:10853975-10853997 CCAACAGACTGTATAAGATGAGG No data
1186584179_1186584183 15 Left 1186584179 X:10853948-10853970 CCTTCCACATCATGCAAATAGAA No data
Right 1186584183 X:10853986-10854008 TATAAGATGAGGTTGTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186584179 Original CRISPR TTCTATTTGCATGATGTGGA AGG (reversed) Intergenic
No off target data available for this crispr