ID: 1186596309

View in Genome Browser
Species Human (GRCh38)
Location X:10985357-10985379
Sequence AGAGACTTGAAGAATGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186596309_1186596313 21 Left 1186596309 X:10985357-10985379 CCCTCCACATTCTTCAAGTCTCT No data
Right 1186596313 X:10985401-10985423 GAATGCTTTCTCTTCTACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186596309 Original CRISPR AGAGACTTGAAGAATGTGGA GGG (reversed) Intergenic
No off target data available for this crispr