ID: 1186596313 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:10985401-10985423 |
| Sequence | GAATGCTTTCTCTTCTACCT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1186596309_1186596313 | 21 | Left | 1186596309 | X:10985357-10985379 | CCCTCCACATTCTTCAAGTCTCT | No data | ||
| Right | 1186596313 | X:10985401-10985423 | GAATGCTTTCTCTTCTACCTTGG | No data | ||||
| 1186596308_1186596313 | 30 | Left | 1186596308 | X:10985348-10985370 | CCAGGCTGGCCCTCCACATTCTT | No data | ||
| Right | 1186596313 | X:10985401-10985423 | GAATGCTTTCTCTTCTACCTTGG | No data | ||||
| 1186596310_1186596313 | 20 | Left | 1186596310 | X:10985358-10985380 | CCTCCACATTCTTCAAGTCTCTG | No data | ||
| Right | 1186596313 | X:10985401-10985423 | GAATGCTTTCTCTTCTACCTTGG | No data | ||||
| 1186596311_1186596313 | 17 | Left | 1186596311 | X:10985361-10985383 | CCACATTCTTCAAGTCTCTGCAT | No data | ||
| Right | 1186596313 | X:10985401-10985423 | GAATGCTTTCTCTTCTACCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1186596313 | Original CRISPR | GAATGCTTTCTCTTCTACCT TGG | Intergenic | ||
| No off target data available for this crispr | |||||