ID: 1186596313

View in Genome Browser
Species Human (GRCh38)
Location X:10985401-10985423
Sequence GAATGCTTTCTCTTCTACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186596309_1186596313 21 Left 1186596309 X:10985357-10985379 CCCTCCACATTCTTCAAGTCTCT No data
Right 1186596313 X:10985401-10985423 GAATGCTTTCTCTTCTACCTTGG No data
1186596308_1186596313 30 Left 1186596308 X:10985348-10985370 CCAGGCTGGCCCTCCACATTCTT No data
Right 1186596313 X:10985401-10985423 GAATGCTTTCTCTTCTACCTTGG No data
1186596310_1186596313 20 Left 1186596310 X:10985358-10985380 CCTCCACATTCTTCAAGTCTCTG No data
Right 1186596313 X:10985401-10985423 GAATGCTTTCTCTTCTACCTTGG No data
1186596311_1186596313 17 Left 1186596311 X:10985361-10985383 CCACATTCTTCAAGTCTCTGCAT No data
Right 1186596313 X:10985401-10985423 GAATGCTTTCTCTTCTACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186596313 Original CRISPR GAATGCTTTCTCTTCTACCT TGG Intergenic
No off target data available for this crispr