ID: 1186597803

View in Genome Browser
Species Human (GRCh38)
Location X:11002818-11002840
Sequence GTGTGGATGTTGGGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186597803_1186597814 18 Left 1186597803 X:11002818-11002840 CCCTCCTCCCCCAACATCCACAC No data
Right 1186597814 X:11002859-11002881 ATTAGCTCTTTTTTACATGGTGG No data
1186597803_1186597815 27 Left 1186597803 X:11002818-11002840 CCCTCCTCCCCCAACATCCACAC No data
Right 1186597815 X:11002868-11002890 TTTTTACATGGTGGAAGCAAAGG No data
1186597803_1186597813 15 Left 1186597803 X:11002818-11002840 CCCTCCTCCCCCAACATCCACAC No data
Right 1186597813 X:11002856-11002878 TCAATTAGCTCTTTTTTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186597803 Original CRISPR GTGTGGATGTTGGGGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr