ID: 1186602034

View in Genome Browser
Species Human (GRCh38)
Location X:11048606-11048628
Sequence AGGGAGAGCACAGTGTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186602034_1186602043 17 Left 1186602034 X:11048606-11048628 CCCCCAGACACTGTGCTCTCCCT No data
Right 1186602043 X:11048646-11048668 TCTCTGCACTGCACAGCCACTGG No data
1186602034_1186602044 27 Left 1186602034 X:11048606-11048628 CCCCCAGACACTGTGCTCTCCCT No data
Right 1186602044 X:11048656-11048678 GCACAGCCACTGGCAGAAGATGG No data
1186602034_1186602045 28 Left 1186602034 X:11048606-11048628 CCCCCAGACACTGTGCTCTCCCT No data
Right 1186602045 X:11048657-11048679 CACAGCCACTGGCAGAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186602034 Original CRISPR AGGGAGAGCACAGTGTCTGG GGG (reversed) Intergenic
No off target data available for this crispr