ID: 1186604040

View in Genome Browser
Species Human (GRCh38)
Location X:11070416-11070438
Sequence ACACTTTCCAAACCAATGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186604040_1186604041 5 Left 1186604040 X:11070416-11070438 CCAGACATTGGTTTGGAAAGTGT No data
Right 1186604041 X:11070444-11070466 TAATCTGTGTTCTACTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186604040 Original CRISPR ACACTTTCCAAACCAATGTC TGG (reversed) Intergenic
No off target data available for this crispr