ID: 1186607546

View in Genome Browser
Species Human (GRCh38)
Location X:11107809-11107831
Sequence AGTCAGAAGCAGACACTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186607546_1186607549 28 Left 1186607546 X:11107809-11107831 CCTTCCAGTGTCTGCTTCTGACT No data
Right 1186607549 X:11107860-11107882 GAAACTACACTGTAATGATAGGG No data
1186607546_1186607548 27 Left 1186607546 X:11107809-11107831 CCTTCCAGTGTCTGCTTCTGACT No data
Right 1186607548 X:11107859-11107881 AGAAACTACACTGTAATGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186607546 Original CRISPR AGTCAGAAGCAGACACTGGA AGG (reversed) Intergenic
No off target data available for this crispr