ID: 1186608048

View in Genome Browser
Species Human (GRCh38)
Location X:11111684-11111706
Sequence GTGGTGACCCGGGTGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 302}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186608048_1186608064 25 Left 1186608048 X:11111684-11111706 CCCTCCTCCACCCGGGTCACCAC 0: 1
1: 0
2: 3
3: 26
4: 302
Right 1186608064 X:11111732-11111754 CGCCTCAGGCCTGTACCTCCTGG 0: 1
1: 0
2: 1
3: 9
4: 140
1186608048_1186608058 11 Left 1186608048 X:11111684-11111706 CCCTCCTCCACCCGGGTCACCAC 0: 1
1: 0
2: 3
3: 26
4: 302
Right 1186608058 X:11111718-11111740 CCTCGCCCCACTCCCGCCTCAGG 0: 1
1: 0
2: 2
3: 32
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186608048 Original CRISPR GTGGTGACCCGGGTGGAGGA GGG (reversed) Intronic
900397877 1:2460668-2460690 CTGATGACCCTGGTGGAGGCTGG + Intronic
901143952 1:7052889-7052911 GAGGGGAGCAGGGTGGAGGAGGG - Intronic
901200239 1:7462893-7462915 GTGGGCACACGGGTGGAGGGAGG - Intronic
901526446 1:9825670-9825692 GAGGTCAGCTGGGTGGAGGATGG - Intergenic
902731622 1:18373647-18373669 GGGGTGCCCTGGGTGGAAGAAGG + Intronic
903292852 1:22325756-22325778 AGGGTGACCAGGGTGGAGGGTGG - Intergenic
903851840 1:26311937-26311959 GTGGTGATGTGGGTGGAGAAGGG - Intronic
904297146 1:29527294-29527316 CTGGTGACCCTGGAGGAGAAGGG + Intergenic
904886173 1:33740240-33740262 GTGATGCCCCTGCTGGAGGAAGG - Intronic
909617184 1:77624332-77624354 GTGGAGTCCTGGGTGGAGGATGG + Intronic
910458336 1:87422076-87422098 GTGAAGACCCAGGTGGAAGATGG - Intergenic
910937273 1:92494596-92494618 GGGGTGACCAGTGTGGAGGTTGG + Intergenic
914315631 1:146508861-146508883 GTGAAGACCCAGGTGGAAGATGG - Intergenic
914498724 1:148224500-148224522 GTGAAGACCCAGGTGGAAGATGG + Intergenic
914980709 1:152412066-152412088 GTGCTGAGCCGGGTGGAGAGGGG - Intronic
915215534 1:154338156-154338178 GTGGTGACTGGGCTGGATGAAGG + Intronic
915362520 1:155294719-155294741 CTGGTGACCCAAGTGGAGAACGG - Exonic
916930715 1:169575716-169575738 TTGGGGAGCTGGGTGGAGGAGGG + Intronic
917737656 1:177935113-177935135 GTGGAGATCAGGGTGGAGCATGG - Intronic
918125612 1:181580790-181580812 GTGGGGACCTGGAAGGAGGAGGG + Intronic
918372169 1:183871466-183871488 TTGCAGACCTGGGTGGAGGAGGG + Intronic
919781576 1:201224694-201224716 GAGGTGACCTGGCTGAAGGATGG + Exonic
919910680 1:202108870-202108892 GTGGTGACCTTGGTGGAGGCAGG - Intergenic
920170599 1:204070087-204070109 CTGGAGACCAGGATGGAGGAGGG + Intergenic
920506403 1:206518319-206518341 GTGGAGTGCCGGGTGGGGGAGGG - Intronic
921051724 1:211515900-211515922 GTCCTGAACCTGGTGGAGGAAGG - Intergenic
922322605 1:224501940-224501962 GTGGTGAGGAGGCTGGAGGAAGG + Intronic
1065020026 10:21495937-21495959 GTGGGGACGCTGGGGGAGGAAGG + Exonic
1066473662 10:35724078-35724100 GTGGGGACCAGGGTAGGGGATGG - Intergenic
1067474493 10:46556812-46556834 GTGGGGACCCGGCCTGAGGAGGG - Intergenic
1069550352 10:69360052-69360074 GGGGTGACCCGGAGGGAGCAGGG - Intronic
1071561837 10:86651478-86651500 GTGGCGAGGCGGGTGGAGGGAGG - Intergenic
1072308977 10:94136214-94136236 GTGGTTACCGGGGATGAGGAAGG + Intronic
1072578150 10:96718978-96719000 GAGGTGGCCAGGGTGGAGAAAGG - Intronic
1073327316 10:102650369-102650391 GTGGGGGCCCAGGTGGTGGAGGG + Intronic
1074497370 10:113991911-113991933 TTTGTGAGCCAGGTGGAGGAGGG + Intergenic
1074532299 10:114305834-114305856 GAGGGGACGCGGGTGCAGGAGGG + Intronic
1074532305 10:114305852-114305874 GAGGGGACGCGGGTGCAGGAGGG + Intronic
1074532319 10:114305888-114305910 GAGGGGACGCGGGTGCAGGAGGG + Intronic
1076483618 10:130801495-130801517 GTGGTGACTCGGCTGCCGGATGG + Intergenic
1076528323 10:131126755-131126777 GTGCTGCCCTGGGTGGAGGTAGG - Intronic
1076733918 10:132450481-132450503 GAGGGGACCGGGGTGGGGGATGG - Intergenic
1076863802 10:133157702-133157724 GTGCTGAGGCGGGTGGAGCAGGG - Intergenic
1076903341 10:133350538-133350560 CATGTGACCCAGGTGGAGGAGGG + Intronic
1077024522 11:433317-433339 GTGGTGACCGGGATGGTGGTCGG + Exonic
1077103218 11:831188-831210 GTGGTGACCCGGCTGCAGGAAGG - Intronic
1077187689 11:1242830-1242852 GTGGTGCCCAGGGAGGAAGAGGG - Exonic
1077187775 11:1243154-1243176 GTGGTCCCCGGGATGGAGGAGGG - Exonic
1077188052 11:1244243-1244265 GTGGTCCCTGGGGTGGAGGACGG - Exonic
1077188111 11:1244501-1244523 GTGGTGCCCAGGGAGGAGGAGGG - Exonic
1077188196 11:1244825-1244847 GTGGTCCCCGGGATGGAGGAGGG - Exonic
1077188541 11:1246166-1246188 GTGGTCTCCGGAGTGGAGGAGGG - Exonic
1077188587 11:1246340-1246362 GTGGTCCCTGGGGTGGAGGACGG - Exonic
1077188731 11:1246925-1246947 GTGGTCCCCGGGATGGAGGAGGG - Exonic
1077189007 11:1248014-1248036 GTGGTCCCTGGGGTGGAGGACGG - Exonic
1077189066 11:1248272-1248294 GTGGTGCCCAGGGAGGAGGAGGG - Exonic
1077189478 11:1249859-1249881 GTGGTCCCAAGGGTGGAGGAGGG - Exonic
1077189503 11:1249937-1249959 GTGGTCTCCGGAGTGGAGGAGGG - Exonic
1077189549 11:1250111-1250133 GTGGTCCCTGGGGTGGAGGACGG - Exonic
1077189570 11:1250198-1250220 GTGGTCCCTGGGGTGGAGGACGG - Exonic
1077189629 11:1250456-1250478 GTGGTGCCCAGGGAGGAGGAGGG - Exonic
1077189720 11:1250795-1250817 GTGGTCCCCGGGATGGAGGAGGG - Exonic
1077189797 11:1251140-1251162 GTGGTCCACAGGGTGGAGGAGGG - Exonic
1077305630 11:1867594-1867616 GGGGTGATGCGGGTGGAGGAGGG - Intronic
1077470832 11:2759816-2759838 GAGATGCCCAGGGTGGAGGAGGG - Intronic
1077839399 11:5958784-5958806 GAGGTGATCAGGGAGGAGGAGGG - Intergenic
1078397894 11:10998091-10998113 GTGTTTACCTGGGAGGAGGAAGG - Intergenic
1078920570 11:15826620-15826642 GAGGTGACCTGGCTGGAGGGAGG - Intergenic
1080893161 11:36427050-36427072 GTGATGACCCGGGAGGAGCTGGG + Intronic
1081967728 11:47179622-47179644 GTGGAGTCCTGGGTGGAAGAAGG - Intronic
1083458376 11:62794333-62794355 GTGGGCACCGGGCTGGAGGAAGG + Exonic
1084207809 11:67606155-67606177 GTGATGACCCTGGCGAAGGACGG + Intronic
1084402995 11:68955968-68955990 GTGGGGACCAGGGTGGGGGTAGG + Intergenic
1084411993 11:69010778-69010800 GGGGTGACCCTGCTGGAGGCTGG + Intronic
1084531310 11:69729465-69729487 CTGGGGTCCCTGGTGGAGGAGGG - Intergenic
1089260166 11:117218776-117218798 GCTGTGTCCAGGGTGGAGGAGGG + Intronic
1089362179 11:117898203-117898225 CTTGGGACCGGGGTGGAGGAGGG + Intergenic
1089466538 11:118689744-118689766 GTGGAGAGCCCGGTGGCGGAGGG - Intergenic
1089633267 11:119796546-119796568 GTGCTGACCCCCTTGGAGGAAGG + Intergenic
1090053504 11:123401651-123401673 GTGGTGGCAGGGGTGGGGGAAGG + Intergenic
1092466931 12:8741541-8741563 GTGGTGAGGCGGGTGGATCACGG + Intronic
1093930169 12:24948467-24948489 GAGTTGACCCGGGTGGAGAGGGG - Intronic
1095699213 12:45174143-45174165 GTGGTGATCCTGGTGGAGTGTGG + Intergenic
1096257490 12:50072333-50072355 AAGGTGACCCGAGGGGAGGAGGG - Intronic
1097178269 12:57156220-57156242 GTTGTCACCCGGGTGGACAAGGG + Exonic
1097405246 12:59181519-59181541 GGGATTACCAGGGTGGAGGATGG - Intergenic
1098303392 12:69077572-69077594 GTGGTGACCGGGGCTGGGGATGG + Intergenic
1098603129 12:72357376-72357398 GTGGTTACCAGGGTTGAGGTAGG - Intronic
1099273951 12:80551363-80551385 GTGGTGGCCAAGGTGGAGAAGGG - Intronic
1100186513 12:92145507-92145529 GTGGCGGCCCGGGTGTAGAAGGG + Exonic
1101623701 12:106417355-106417377 CTGGAGACCCAGGTGGAGGCTGG + Intronic
1102124492 12:110469082-110469104 GTCGTGAGCCCCGTGGAGGAGGG + Intronic
1102509209 12:113402859-113402881 GTTGTGCCCGGGGAGGAGGAGGG + Intronic
1103554562 12:121758398-121758420 GTGGTCACCATGGAGGAGGACGG + Intronic
1103554573 12:121758435-121758457 GTGGTCACCATGGAGGAGGATGG + Intronic
1103554593 12:121758509-121758531 GTGGTCACCATGGAGGAGGATGG + Intronic
1103554613 12:121758583-121758605 GTGGTCACCATGGAGGAGGACGG + Intronic
1103554624 12:121758620-121758642 GTGGTCACCATGGAGGAGGACGG + Intronic
1103554635 12:121758657-121758679 GTGGTCACCATGGAGGAGGATGG + Intronic
1103554643 12:121758694-121758716 GTGGTCACCATGGAGGAGGACGG + Intronic
1103554652 12:121758731-121758753 GTGGTCACCATGGAGGAGGACGG + Intronic
1103554662 12:121758768-121758790 GTGGTCACCATGGAGGAGGACGG + Intronic
1103554672 12:121758805-121758827 GTGGTCACCATGGAGGAGGACGG + Intronic
1103554690 12:121758879-121758901 GTGGTCACCATGGAGGAGGACGG + Intronic
1103554700 12:121758916-121758938 GTGGTCACCATGGAGGAGGACGG + Intronic
1104608331 12:130206011-130206033 GTGGTGTCCCTGGAGGCGGACGG + Intergenic
1104702438 12:130917532-130917554 GTGGTAAACAGGGTGGAGGTAGG - Intergenic
1104773304 12:131378327-131378349 GTGGTGATCGCGGTGGAGGTGGG + Intergenic
1104920794 12:132289722-132289744 ATGGAGCCCCGGGTGGAGGGAGG - Intronic
1107435387 13:40376741-40376763 TTGCTGGCCTGGGTGGAGGATGG - Intergenic
1110916806 13:81030978-81031000 GTGGTGCCTTGGGTTGAGGAAGG + Intergenic
1111386543 13:87536217-87536239 GTGGTGCCCCAGGGAGAGGATGG + Intergenic
1112344030 13:98576338-98576360 GTGGTGGCCGGGTTGGCGGAGGG - Intronic
1113599431 13:111558149-111558171 GGGTTGACCCTGCTGGAGGAAGG + Intergenic
1114416920 14:22551109-22551131 CTGGGGACCCTGGGGGAGGAGGG - Intergenic
1114530809 14:23394750-23394772 GGGGTGACAGGGGTGTAGGAAGG - Intronic
1119783070 14:77291373-77291395 GTGGTGACCTGGGTGGGGGGTGG + Exonic
1121137912 14:91514843-91514865 GTGGTCAAGCGTGTGGAGGATGG + Intergenic
1122901460 14:104783958-104783980 GTGGGGGGCCGAGTGGAGGACGG + Intronic
1124251665 15:28110222-28110244 GTGGTGACACAGGTGTAAGAGGG - Intergenic
1127364838 15:58279095-58279117 GTGGTGACCCCCGAGGTGGAAGG + Intronic
1128374508 15:67065677-67065699 GCGGCGAGCCGGGAGGAGGAGGG + Intronic
1128842110 15:70858851-70858873 GGGGTGGCCTGGGTGGAGGCTGG + Intronic
1129394372 15:75236073-75236095 GTGGTGAACTGGGAGGAAGAGGG - Intergenic
1131405798 15:92163460-92163482 GTGGTGGCCAGCTTGGAGGATGG + Exonic
1132313432 15:100873926-100873948 GTGGAGACCAAGGTGGGGGATGG - Intergenic
1132831788 16:1932101-1932123 GTGGTGATCCTGGTGGGGGCTGG - Intergenic
1132937160 16:2486977-2486999 CTGGTGGCCCTGGAGGAGGAAGG - Intronic
1132973838 16:2701847-2701869 CTGGTGACCCGGAGGGAGGCAGG + Intronic
1133126885 16:3652909-3652931 GTGGTCCCCCTGGGGGAGGAGGG - Intronic
1133276406 16:4640794-4640816 GTGGTCCCCCGGCTGCAGGAGGG + Intronic
1133879283 16:9765279-9765301 TTGGTGACCCGGGTGCTGGGAGG - Intronic
1134353422 16:13459323-13459345 CTGGTGACATGGGGGGAGGAGGG + Intergenic
1135724806 16:24846085-24846107 GTGAGGACCCTGGTGGAGGACGG + Exonic
1136075037 16:27811482-27811504 GTGGTGTTCCGGGATGAGGAGGG - Intronic
1136126412 16:28185425-28185447 GTGGTTACCTTGGAGGAGGAGGG + Intronic
1136270267 16:29144356-29144378 GTGGGGGCGCGGGTGGAGGCTGG - Intergenic
1136328453 16:29551295-29551317 GTGATGACACTGATGGAGGAGGG + Intergenic
1136443138 16:30291309-30291331 GTGATGACACTGATGGAGGAGGG + Intergenic
1136547721 16:30965064-30965086 GTGGAGGCGGGGGTGGAGGAGGG + Exonic
1138116213 16:54362573-54362595 GAGGTGGCCCAGGTGGAGGGTGG - Intergenic
1138583908 16:57958367-57958389 GTGGTGGCCCTGGTGGTGGTGGG - Intronic
1142073857 16:88106190-88106212 GTGGGGGCGCGGGTGGAGGCTGG - Intronic
1142715980 17:1747192-1747214 GTCCTGCCCTGGGTGGAGGAGGG + Intronic
1144956867 17:19023073-19023095 GTGGTGAACAGGGAGGAGGATGG + Intronic
1144994893 17:19260745-19260767 GTGGTTACCAGGGAGGAGGGAGG - Intronic
1145031380 17:19507571-19507593 GTGGGGACGCGGGTGGAGGAGGG - Intronic
1145997327 17:29112163-29112185 GAGGGGACGAGGGTGGAGGAGGG - Intronic
1146937329 17:36820321-36820343 GTGGGGGGCAGGGTGGAGGATGG - Intergenic
1147157617 17:38552173-38552195 GTGGTGACCCTTCTGCAGGAAGG + Intronic
1147338330 17:39739878-39739900 GGGGTGAGCAGGGAGGAGGAAGG - Intronic
1147901064 17:43785150-43785172 CTGGAGACCCTGGTGGAGCAGGG + Exonic
1148489221 17:48012519-48012541 GTAGTGGGCCGGGCGGAGGAGGG - Intergenic
1148541273 17:48482542-48482564 GTGGTGAACAGAGAGGAGGAGGG + Intergenic
1148693565 17:49546280-49546302 GTGGTGAGCTGGGTGGAGGTGGG + Intergenic
1148855284 17:50575871-50575893 GTGGTGCACCAGGTGGTGGACGG - Exonic
1148872811 17:50668682-50668704 GTGGGGAGCCCTGTGGAGGAGGG - Intronic
1150433854 17:65139265-65139287 GGGGAGACCGGGGTGGAAGATGG - Intronic
1151517725 17:74607008-74607030 GTTCTGAGCCGGGTGGGGGATGG - Intergenic
1151583211 17:74991961-74991983 GGGGTAACCAGGGTGGAGGCAGG - Intronic
1151679804 17:75617237-75617259 GTGGTGGCGCTGGTGGAGGTGGG - Intergenic
1151699952 17:75737706-75737728 CTGGGGACCCTGGTGGAGGGTGG - Intronic
1151699997 17:75737814-75737836 GTGGGGACCGTGGTGGAGGATGG - Intronic
1151822219 17:76502421-76502443 TTGCTGACCTGGGTGGAGGTGGG + Intergenic
1152152664 17:78612270-78612292 GTGGCAGCCCGGGTGGAGGAGGG + Intergenic
1152181050 17:78822121-78822143 GTGGTGACTCGGGTGGGGGGTGG - Intronic
1152237904 17:79148008-79148030 GTGGGGCCCCGGGGGGAGGGCGG + Intronic
1152682691 17:81677290-81677312 GTGGCCACCCGGCTGGAGGTGGG - Intergenic
1155341324 18:24817393-24817415 GAGGTGACCCAGCTGGAGGCGGG + Intergenic
1157733496 18:50025358-50025380 GTTGTGAACTGGTTGGAGGAAGG - Intronic
1158566235 18:58556560-58556582 GTGGTGGAGCTGGTGGAGGAAGG + Intronic
1160550898 18:79693202-79693224 GTGGTGACCGGGAGGGAGGATGG + Intronic
1160797664 19:953353-953375 GTGGTGGCGCCGGTGGGGGAGGG - Intronic
1161269541 19:3382294-3382316 GTGGTGACACGGGGCCAGGAGGG + Intronic
1161399255 19:4060178-4060200 GGAGTGGCCCGGGGGGAGGAGGG - Intronic
1161524928 19:4748326-4748348 CTGGTGACCCGGGAGTAGGCTGG - Intergenic
1162145470 19:8610538-8610560 GTGGTGCCCTGGATGGGGGAGGG - Intronic
1162771570 19:12952621-12952643 GTGATGACCTGGGGAGAGGAGGG + Intronic
1163154981 19:15434834-15434856 GTGGTGTCTCTAGTGGAGGATGG - Intronic
1163565181 19:18046838-18046860 GAGGTGACCAGGGTCCAGGAGGG + Intergenic
1165246882 19:34503039-34503061 ATGGTGACCGGGATGGAGCAGGG - Exonic
1165443560 19:35844405-35844427 GTGGTGACCGCGGTGGAGCAGGG - Exonic
1166503050 19:43355040-43355062 GGGGTGGGCAGGGTGGAGGAGGG - Intronic
1166507402 19:43379692-43379714 GGGGTGGGCAGGGTGGAGGAGGG + Intergenic
1167234147 19:48303623-48303645 GTGGGGCCCTGGGTGGAGGGAGG - Intronic
1167648387 19:50717730-50717752 GTGGTGGCCCGGGTAGATGTGGG + Intronic
1167904661 19:52649034-52649056 GTGGGGACCCGGCGGGAGAAGGG - Intronic
1168322459 19:55518264-55518286 GTGATGACAGGGGTTGAGGAAGG - Exonic
925863119 2:8199681-8199703 GTGGTGTGCAGGGTGGAGGCTGG + Intergenic
925992056 2:9261763-9261785 GTGGTGTCCCAGGTGGGAGAGGG + Intronic
926126868 2:10277426-10277448 GTGGTGGACCAGATGGAGGACGG + Intergenic
927514658 2:23665046-23665068 GTGGTGACTCGGGTGGCTGGTGG + Intronic
929294267 2:40228807-40228829 GAGGTGTCAGGGGTGGAGGAGGG + Intronic
929639125 2:43558495-43558517 GTGTTTACCCAGGTGGAGGATGG - Intronic
932572062 2:72943351-72943373 GTGGAGACCCCGGGGGAGGGAGG + Exonic
933638024 2:84728350-84728372 GTGGTGACTCTGGTGGCCGAAGG + Intronic
936012806 2:108936020-108936042 GTGGTGACCAGTAGGGAGGACGG - Intronic
941166725 2:162090805-162090827 GTGGTGACCAGGTTTGGGGATGG + Intergenic
947591595 2:231388964-231388986 GTGGTGGGACAGGTGGAGGAGGG + Intergenic
947701853 2:232241011-232241033 GTGGGGAGCTGGGTGGAGGAAGG + Intronic
948443377 2:238012760-238012782 CTGGTGCCCTAGGTGGAGGAAGG + Intronic
948575793 2:238948702-238948724 GTGGGGACAGGAGTGGAGGAGGG - Intergenic
948635054 2:239329494-239329516 GGGGTGTCCCGGTGGGAGGAGGG - Intronic
949008823 2:241667132-241667154 GTGGAGACCCGGGAGGGGGCGGG - Intronic
1169411299 20:5372583-5372605 GGGGTGACCCAGGTAGAGGCTGG - Intergenic
1172331592 20:34079434-34079456 GGGGTGGCTTGGGTGGAGGAAGG + Intronic
1173511293 20:43630885-43630907 GTGGTGAGCAGAGTGGAGGAAGG + Intronic
1173561163 20:44006623-44006645 GTGGTCCCCCAGGTGCAGGAGGG - Exonic
1175514437 20:59559948-59559970 GTCATGACCCAGCTGGAGGAAGG - Intergenic
1176303732 21:5112847-5112869 GTGGTTACGGGGGTGGAGGGTGG + Intergenic
1176555485 21:8252585-8252607 GTGGCGCCCCGCGTGGAGCACGG + Intergenic
1179487096 21:41717328-41717350 GTCGAGACCCTGATGGAGGAAGG - Intergenic
1179626877 21:42653909-42653931 GCTGTCACCCGGGGGGAGGAGGG - Intronic
1179657279 21:42853165-42853187 GTGGAGCCCCGGGTAGAGGAGGG - Intronic
1179853300 21:44149103-44149125 GTGGTTACGGGGGTGGAGGGTGG - Intergenic
1180001464 21:44997240-44997262 GTGGTGCTCCGGGAGGAGGGTGG + Intergenic
1180006300 21:45022538-45022560 CTGGAGGCCCGGGTGGAAGACGG + Intergenic
1180874251 22:19167493-19167515 GTGGTGACCAAGGTGGAGATGGG - Intergenic
1181098851 22:20525250-20525272 GTGTTGCCCAGGGTGGAGTATGG - Intronic
1181164813 22:20977551-20977573 GTGGGGACCAGGGTGCATGAAGG + Intronic
1181609611 22:24003840-24003862 GTGGTGACCTGGGAGGGGCAGGG + Intergenic
1181694454 22:24585932-24585954 GTGGAGTCCCAGGTGGAGGCAGG + Exonic
1181953147 22:26569296-26569318 GTGGTTACCCCGGTGGGGCAAGG + Intronic
1183160568 22:36110430-36110452 GTTGGGACCCTGGAGGAGGAAGG + Intergenic
1183639329 22:39083612-39083634 GTGGGGAGCCGGGGGAAGGAAGG + Intronic
1185166383 22:49265049-49265071 GTGGGGAGCTGGGTGGGGGAGGG + Intergenic
1185420442 22:50731656-50731678 TTGGTGACTCGGGGGGAGGGGGG + Intergenic
950483920 3:13261591-13261613 GTGATGACGGGGGTGGGGGATGG - Intergenic
950625735 3:14245345-14245367 CTGGGGACGGGGGTGGAGGAGGG - Intergenic
951685443 3:25338837-25338859 GTGGTGACCCTGGTGAGGAAAGG - Intronic
953902129 3:46849394-46849416 GTGGTCACCTGTGTGGAGGGTGG - Intergenic
954333246 3:49901935-49901957 GTGGTGGCGGGGGTGGGGGAGGG + Intronic
954415116 3:50389585-50389607 GTGTTGACCCAGGTGCAGGCAGG - Intronic
954632645 3:52055693-52055715 GTGGGGACCCGGCTCCAGGAGGG + Intronic
955312631 3:57904762-57904784 GTGTGGGCCAGGGTGGAGGAGGG + Intronic
955322732 3:57985874-57985896 GTGGAGACCAGGATGGAGCAGGG + Intergenic
955779602 3:62470287-62470309 GTTGGGACCCAGGTGGAGGCTGG + Intronic
955958671 3:64316861-64316883 CTGGTGCCCAGGGTGGAGGGCGG + Intronic
956906508 3:73771482-73771504 GTGGTTACCCCTGAGGAGGAAGG - Intergenic
959546146 3:107598974-107598996 GCAGTGACCCTGGGGGAGGAAGG + Intronic
962630355 3:137269556-137269578 GTGGTGATGGGGGTGGAGGGAGG + Intergenic
963094400 3:141520375-141520397 GTGGTGTACCTGCTGGAGGAGGG + Intronic
963841255 3:150108932-150108954 GTGGTTGCCGGGGTTGAGGAGGG - Intergenic
967206508 3:187127434-187127456 GTGGTCACCTGTGTGGAGAAGGG + Intronic
967206694 3:187129802-187129824 GTGGTGACCTGGGAGTAGGGAGG - Intronic
967811600 3:193765662-193765684 GTGGTGGGCCAGGTGGAAGATGG + Intergenic
967996880 3:195173631-195173653 GTGGTGGGGAGGGTGGAGGAAGG - Intronic
968984098 4:3866041-3866063 GAGGTGACCCGGGTAGACGTGGG + Intergenic
968984126 4:3866127-3866149 CGGGTGACCCGGGTGGACGAAGG + Intergenic
968984155 4:3866211-3866233 GGGGTGAGCTGGGTGGACGAGGG + Intergenic
969330435 4:6471289-6471311 GGAGTGACCCCGATGGAGGATGG - Intronic
969469887 4:7381547-7381569 GTGGTGTCCCTGGCGGAGGGAGG + Intronic
969496824 4:7530990-7531012 GTGGTGGCCAGGGTGGAGGATGG + Intronic
972590412 4:40480671-40480693 GTGCTGCCTCGGGTAGAGGAAGG - Intronic
975817133 4:78229939-78229961 GTGGTGCCAAGGGTGGAGGTAGG - Intronic
977607341 4:98995996-98996018 GTGGCGACGCGGGTGGGGGGAGG - Intronic
979477891 4:121179809-121179831 GTGGTGGCCAGGGTGGGGGAGGG + Intronic
980541535 4:134201893-134201915 GCGGTGACTGGGGTGGAGAAAGG + Intergenic
985114888 4:186580981-186581003 GAGGTGACAGGAGTGGAGGAGGG - Intergenic
985548871 5:523402-523424 GTGGTCACTCGTGTGGAGGGGGG - Intronic
987111789 5:14694293-14694315 GTGGTGACTGGGGTGGTGAAGGG + Exonic
987679550 5:21117557-21117579 GTGATGACCAGTGTTGAGGAGGG + Intergenic
988934226 5:36066560-36066582 TTGCGGACCCGGCTGGAGGAGGG - Intronic
990157163 5:52890164-52890186 ATGGTTACCCAGGTGGAGGAAGG - Intronic
990825627 5:59894193-59894215 GTGGGGAGCAGTGTGGAGGAGGG - Intronic
992515873 5:77492061-77492083 GCGGGGACCCGGGCGGAGGCGGG - Intronic
992849904 5:80796846-80796868 GAGGTGGGCAGGGTGGAGGAGGG - Intronic
995031523 5:107487228-107487250 GTGTTCACCCGGGGGGAAGAGGG - Intronic
995313387 5:110739061-110739083 GTGGTGGCCCCGGTGGTGGTGGG + Exonic
998003710 5:138643506-138643528 GTGGTGGCTGGTGTGGAGGATGG + Intronic
1002102034 5:176862446-176862468 ATGGAGGCCCGGGTGGGGGATGG + Intronic
1002451659 5:179322428-179322450 GTGCGGACCTGGGTGGGGGAGGG - Intronic
1003678534 6:8229342-8229364 GTCCTGACCCAGTTGGAGGAAGG - Intergenic
1005277186 6:24231567-24231589 GTGGTGATAGTGGTGGAGGATGG - Intronic
1006337476 6:33428083-33428105 GGGGTGTCCCCGGTGGGGGAGGG - Intronic
1006384677 6:33723773-33723795 GAGGGGAGCCTGGTGGAGGAGGG + Intronic
1006524338 6:34590882-34590904 TTTGTGACCTGGGTGGAGGAAGG - Intronic
1008543619 6:52566630-52566652 GTGGGGACAAGGGTGGAGGTGGG - Intronic
1014947447 6:127515480-127515502 GGGGGGACCCGGCTGGGGGATGG - Intronic
1018291779 6:162298827-162298849 GGGCTGAGCCAGGTGGAGGAGGG + Intronic
1018440284 6:163806151-163806173 GTGGTGAGGCCAGTGGAGGAGGG + Intergenic
1018726135 6:166614752-166614774 GAGGTTACAGGGGTGGAGGAAGG - Intronic
1019455417 7:1124309-1124331 GTGGGGATCTGGCTGGAGGAGGG + Intronic
1019502061 7:1369412-1369434 GTGGTGGGCGGGGTGCAGGATGG - Intergenic
1019983878 7:4641557-4641579 GTGGTGACCTGGATGGAGGGCGG - Intergenic
1021510139 7:21426180-21426202 TTGGTGAACTGGGAGGAGGAGGG + Intergenic
1021939999 7:25669682-25669704 ATGGAGACTCGGGTGGGGGAAGG + Intergenic
1023670860 7:42575195-42575217 GTGGTGACCAAGATGGTGGATGG + Intergenic
1023839046 7:44085708-44085730 GGGGTGTCCCTGCTGGAGGATGG + Intergenic
1029173439 7:98646783-98646805 GTGGTCAGCCTGGAGGAGGAGGG - Intergenic
1032095236 7:128935001-128935023 GTGGGGAGCAGGGGGGAGGAGGG - Intergenic
1033352937 7:140577056-140577078 GTGGTCACCCTGCTGGAGAAAGG + Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1035992829 8:4511064-4511086 GTGCTGACCAGGCTGAAGGATGG - Intronic
1036640325 8:10579592-10579614 GTGGGGGGCCGGGTGGGGGAAGG - Intergenic
1039845816 8:41324774-41324796 GTGGTGGGGTGGGTGGAGGAGGG + Intergenic
1042696653 8:71561088-71561110 GTGGAACCCGGGGTGGAGGAGGG - Intronic
1043987423 8:86710130-86710152 GTGGTGGCCAGGTTGGAGAATGG - Intronic
1044477226 8:92642038-92642060 GTGGTGAGACGGTTGGAAGAAGG - Intergenic
1046598254 8:116286744-116286766 ATGGTGACCCTGGTGAAGGGAGG - Intergenic
1048077940 8:131093920-131093942 GTGGTGTCCTTGGTGGAGGTTGG + Intergenic
1049280116 8:141739960-141739982 GCGGTGACCCGGGTGCAGCCTGG + Intergenic
1049542657 8:143215532-143215554 GGGGTGAGCCGGGTGGGGGTGGG - Intergenic
1049644102 8:143728414-143728436 GTGGCGGTCCGGGTCGAGGAAGG + Exonic
1051658997 9:19408823-19408845 GGCGGGACCCGCGTGGAGGAGGG - Intergenic
1052197570 9:25736193-25736215 GTGGAGACCAGGTTGCAGGATGG - Intergenic
1053313399 9:37033897-37033919 AGGGTGACCCTGGAGGAGGAGGG - Intronic
1056719496 9:89059984-89060006 GTGGTGGACATGGTGGAGGATGG + Intronic
1057003056 9:91530589-91530611 GTGGTCATCTGGTTGGAGGAAGG - Intergenic
1057386315 9:94608611-94608633 GTGGTGACCTGGGTAGGGGTGGG - Intronic
1057818669 9:98314784-98314806 AAGGTGGCCTGGGTGGAGGAAGG - Intronic
1059444078 9:114327524-114327546 GTGGGGACCAGGCTGGAGGCAGG + Intergenic
1059445285 9:114334303-114334325 GTGGGGACCAGGCTGGAGGCAGG + Exonic
1060197195 9:121631439-121631461 GTGGTGCCCAGGGAGGAGCAGGG + Intronic
1060393718 9:123300794-123300816 GTGCTGACAGAGGTGGAGGAGGG + Intergenic
1060583238 9:124770667-124770689 GAGGGGACCCGGGGGGAGGAGGG + Intronic
1061208397 9:129177244-129177266 GTGGTGACCACGGTGGAGAACGG - Exonic
1061574819 9:131499599-131499621 TTGGTGGCCCTGGTGGAGCATGG - Exonic
1061994150 9:134175510-134175532 GTGGTTGCCCGGGTGGAGTGCGG + Intergenic
1062567871 9:137171296-137171318 GTGCTGTCCCTGGAGGAGGAGGG - Intronic
1203771162 EBV:50730-50752 GTGGGGAGGCGGGTGGCGGAGGG + Intergenic
1186608048 X:11111684-11111706 GTGGTGACCCGGGTGGAGGAGGG - Intronic
1189902247 X:45718484-45718506 GTGCTTACCAGAGTGGAGGAGGG + Intergenic
1190375436 X:49784332-49784354 GGGGTGTCCCGTGAGGAGGAGGG + Intergenic
1190873790 X:54445779-54445801 GTGGGGAACTGGGTGGAGGCAGG + Exonic
1190916271 X:54813289-54813311 GTTCTGACCTGGGTGGATGATGG + Intronic
1190928143 X:54926754-54926776 GTTCTGACCTGGGTGGATGACGG + Intronic
1191605399 X:63057256-63057278 ATGCTGACCCCAGTGGAGGAAGG + Intergenic
1195315565 X:103674534-103674556 GTGGGGAGGGGGGTGGAGGAGGG - Intergenic
1196857524 X:119998445-119998467 CTGTTGACCAGGCTGGAGGAGGG + Intergenic
1198219134 X:134583844-134583866 GTGGTAACAGGGGTGGATGAAGG - Intronic
1199995397 X:153021598-153021620 GTGGTGAACAGGAGGGAGGAGGG - Intergenic