ID: 1186609553

View in Genome Browser
Species Human (GRCh38)
Location X:11125673-11125695
Sequence TGTTATTTAAAATCATCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186609552_1186609553 11 Left 1186609552 X:11125639-11125661 CCAGGTGTTTGGGTGCTTGCTCT No data
Right 1186609553 X:11125673-11125695 TGTTATTTAAAATCATCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186609553 Original CRISPR TGTTATTTAAAATCATCAAA TGG Intergenic
No off target data available for this crispr