ID: 1186610143

View in Genome Browser
Species Human (GRCh38)
Location X:11130948-11130970
Sequence AGCACATTGAGCTTCGCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186610143_1186610149 26 Left 1186610143 X:11130948-11130970 CCTTTTGCGAAGCTCAATGTGCT No data
Right 1186610149 X:11130997-11131019 CAGCTCATGCATGCCTCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186610143 Original CRISPR AGCACATTGAGCTTCGCAAA AGG (reversed) Intergenic
No off target data available for this crispr