ID: 1186610145

View in Genome Browser
Species Human (GRCh38)
Location X:11130971-11130993
Sequence ATGCAGTCTGTGGAAGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186610145_1186610155 29 Left 1186610145 X:11130971-11130993 CCTGGCCCTTCCACAGACTGCAT No data
Right 1186610155 X:11131023-11131045 TCTCTTGGTGAGAGAAGAGGGGG No data
1186610145_1186610153 27 Left 1186610145 X:11130971-11130993 CCTGGCCCTTCCACAGACTGCAT No data
Right 1186610153 X:11131021-11131043 AGTCTCTTGGTGAGAGAAGAGGG No data
1186610145_1186610150 14 Left 1186610145 X:11130971-11130993 CCTGGCCCTTCCACAGACTGCAT No data
Right 1186610150 X:11131008-11131030 TGCCTCTGATGGAAGTCTCTTGG No data
1186610145_1186610154 28 Left 1186610145 X:11130971-11130993 CCTGGCCCTTCCACAGACTGCAT No data
Right 1186610154 X:11131022-11131044 GTCTCTTGGTGAGAGAAGAGGGG No data
1186610145_1186610149 3 Left 1186610145 X:11130971-11130993 CCTGGCCCTTCCACAGACTGCAT No data
Right 1186610149 X:11130997-11131019 CAGCTCATGCATGCCTCTGATGG No data
1186610145_1186610152 26 Left 1186610145 X:11130971-11130993 CCTGGCCCTTCCACAGACTGCAT No data
Right 1186610152 X:11131020-11131042 AAGTCTCTTGGTGAGAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186610145 Original CRISPR ATGCAGTCTGTGGAAGGGCC AGG (reversed) Intergenic
No off target data available for this crispr