ID: 1186610148

View in Genome Browser
Species Human (GRCh38)
Location X:11130981-11131003
Sequence TGAGCTGCTCATGCAGTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186610148_1186610150 4 Left 1186610148 X:11130981-11131003 CCACAGACTGCATGAGCAGCTCA No data
Right 1186610150 X:11131008-11131030 TGCCTCTGATGGAAGTCTCTTGG No data
1186610148_1186610149 -7 Left 1186610148 X:11130981-11131003 CCACAGACTGCATGAGCAGCTCA No data
Right 1186610149 X:11130997-11131019 CAGCTCATGCATGCCTCTGATGG No data
1186610148_1186610154 18 Left 1186610148 X:11130981-11131003 CCACAGACTGCATGAGCAGCTCA No data
Right 1186610154 X:11131022-11131044 GTCTCTTGGTGAGAGAAGAGGGG No data
1186610148_1186610157 23 Left 1186610148 X:11130981-11131003 CCACAGACTGCATGAGCAGCTCA No data
Right 1186610157 X:11131027-11131049 TTGGTGAGAGAAGAGGGGGAGGG No data
1186610148_1186610152 16 Left 1186610148 X:11130981-11131003 CCACAGACTGCATGAGCAGCTCA No data
Right 1186610152 X:11131020-11131042 AAGTCTCTTGGTGAGAGAAGAGG No data
1186610148_1186610156 22 Left 1186610148 X:11130981-11131003 CCACAGACTGCATGAGCAGCTCA No data
Right 1186610156 X:11131026-11131048 CTTGGTGAGAGAAGAGGGGGAGG No data
1186610148_1186610153 17 Left 1186610148 X:11130981-11131003 CCACAGACTGCATGAGCAGCTCA No data
Right 1186610153 X:11131021-11131043 AGTCTCTTGGTGAGAGAAGAGGG No data
1186610148_1186610155 19 Left 1186610148 X:11130981-11131003 CCACAGACTGCATGAGCAGCTCA No data
Right 1186610155 X:11131023-11131045 TCTCTTGGTGAGAGAAGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186610148 Original CRISPR TGAGCTGCTCATGCAGTCTG TGG (reversed) Intergenic
No off target data available for this crispr