ID: 1186610151

View in Genome Browser
Species Human (GRCh38)
Location X:11131010-11131032
Sequence CACCAAGAGACTTCCATCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186610151_1186610156 -7 Left 1186610151 X:11131010-11131032 CCTCTGATGGAAGTCTCTTGGTG No data
Right 1186610156 X:11131026-11131048 CTTGGTGAGAGAAGAGGGGGAGG No data
1186610151_1186610157 -6 Left 1186610151 X:11131010-11131032 CCTCTGATGGAAGTCTCTTGGTG No data
Right 1186610157 X:11131027-11131049 TTGGTGAGAGAAGAGGGGGAGGG No data
1186610151_1186610155 -10 Left 1186610151 X:11131010-11131032 CCTCTGATGGAAGTCTCTTGGTG No data
Right 1186610155 X:11131023-11131045 TCTCTTGGTGAGAGAAGAGGGGG No data
1186610151_1186610158 29 Left 1186610151 X:11131010-11131032 CCTCTGATGGAAGTCTCTTGGTG No data
Right 1186610158 X:11131062-11131084 CTGATCCCCTGCAAAGCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186610151 Original CRISPR CACCAAGAGACTTCCATCAG AGG (reversed) Intergenic
No off target data available for this crispr