ID: 1186610154

View in Genome Browser
Species Human (GRCh38)
Location X:11131022-11131044
Sequence GTCTCTTGGTGAGAGAAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186610147_1186610154 22 Left 1186610147 X:11130977-11130999 CCTTCCACAGACTGCATGAGCAG No data
Right 1186610154 X:11131022-11131044 GTCTCTTGGTGAGAGAAGAGGGG No data
1186610148_1186610154 18 Left 1186610148 X:11130981-11131003 CCACAGACTGCATGAGCAGCTCA No data
Right 1186610154 X:11131022-11131044 GTCTCTTGGTGAGAGAAGAGGGG No data
1186610146_1186610154 23 Left 1186610146 X:11130976-11130998 CCCTTCCACAGACTGCATGAGCA No data
Right 1186610154 X:11131022-11131044 GTCTCTTGGTGAGAGAAGAGGGG No data
1186610145_1186610154 28 Left 1186610145 X:11130971-11130993 CCTGGCCCTTCCACAGACTGCAT No data
Right 1186610154 X:11131022-11131044 GTCTCTTGGTGAGAGAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186610154 Original CRISPR GTCTCTTGGTGAGAGAAGAG GGG Intergenic
No off target data available for this crispr