ID: 1186611475

View in Genome Browser
Species Human (GRCh38)
Location X:11142112-11142134
Sequence TGGGAAATGCTGAAAATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 1, 2: 5, 3: 24, 4: 285}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186611475 Original CRISPR TGGGAAATGCTGAAAATGGG AGG (reversed) Intronic
901382989 1:8887363-8887385 TGGGAGGTGCTGAAACAGGGAGG + Intergenic
902058411 1:13621268-13621290 TGGGATATGAGAAAAATGGGAGG + Intergenic
902649568 1:17827753-17827775 TGGCAAATGCTGCAGATGGAAGG + Intergenic
903315407 1:22500539-22500561 TGGGAAAGGCTGAAAAGGAGTGG + Intronic
903702135 1:25257228-25257250 TGATAAATGCTAAAAATAGGAGG - Intronic
904190248 1:28737503-28737525 AGGAAGAGGCTGAAAATGGGAGG - Intronic
907714233 1:56912643-56912665 TGGGACAGGCTGGAACTGGGTGG - Intronic
909110016 1:71463242-71463264 TGGGAAATGCAGGGAAGGGGTGG + Intronic
909906353 1:81200490-81200512 TGGGAAATGAAAAAAATGGGTGG + Intergenic
910139919 1:84015953-84015975 TGGTACATGGTGAAAATGGAAGG - Intergenic
910432228 1:87170137-87170159 TGAGAAATGAAGAAAATGGCTGG - Intergenic
910524403 1:88161329-88161351 TGGGAAATGCTGAAAGGGACTGG + Intergenic
910666678 1:89732725-89732747 TGGGAAATACAGGAAGTGGGTGG + Intronic
913276828 1:117146299-117146321 TTGGAAATGATGAAAACTGGCGG + Intronic
915721312 1:157987854-157987876 GGGGAAGGGCTGAAAATGGGTGG + Intergenic
917976060 1:180239236-180239258 TGGGAAATACTGTCAGTGGGGGG - Intronic
917996750 1:180447185-180447207 TAGGAAAGGCTGAAATTTGGAGG - Intronic
918821720 1:189265617-189265639 TGGGTTATGCTCAAAATGGTGGG + Intergenic
919046039 1:192453608-192453630 GGGGAAATGATGATAATGGATGG - Intergenic
919347559 1:196404515-196404537 TGGGAAATGCTGGTTATGAGTGG - Intronic
920304555 1:205010206-205010228 AGGGAGAGGCTGAAGATGGGTGG + Intronic
920683064 1:208087764-208087786 TGGTAAGGGCTGAAAGTGGGTGG + Intronic
920880256 1:209873433-209873455 TAGGATATGCAGAAAATTGGTGG + Intergenic
921012509 1:211156681-211156703 TGGGAAATGTTGAATAGGAGTGG + Intergenic
921363228 1:214349912-214349934 TGAGAAATGCTGAGAATGCCAGG + Exonic
921516552 1:216099442-216099464 TGGGATATGTTTCAAATGGGTGG - Intronic
921890192 1:220345989-220346011 AGGGAAAGGAAGAAAATGGGTGG + Intergenic
921893797 1:220378938-220378960 TGGGAACTAGGGAAAATGGGAGG - Intergenic
923238801 1:232060631-232060653 TGTGAAATGCAGCAAATGCGAGG - Intergenic
923978004 1:239286417-239286439 TGAGAAGTGCTTAAAATGGAGGG - Intergenic
924222780 1:241895337-241895359 TGGAAAATTCTGAAGATGGATGG + Intergenic
924367916 1:243316098-243316120 TGAGAATTGCTGAAGAAGGGTGG + Intronic
924669049 1:246104620-246104642 TGGGACAGACTGGAAATGGGGGG + Intronic
1063498627 10:6533108-6533130 TGGGGGATGTTGATAATGGGAGG - Intronic
1065148110 10:22793406-22793428 TGAGAGATGTTGATAATGGGAGG - Intergenic
1066676628 10:37894196-37894218 TGGGACATGCAGAGAATGAGGGG - Intergenic
1068294059 10:55044428-55044450 TGTGAAATACTGAAAATAAGTGG - Intronic
1068952320 10:62789901-62789923 TGGGGAACACTGAAATTGGGTGG + Intergenic
1068992960 10:63169757-63169779 ACAGAAATGCTGAAAATGTGAGG - Intronic
1071154197 10:82670896-82670918 TGGGAAATGCAGAGAATTGCAGG - Intronic
1072276765 10:93830961-93830983 TGGGGAATGGTGCAAATCGGGGG - Intergenic
1074448074 10:113536835-113536857 TGGGAACTGCTAGAAGTGGGAGG + Intergenic
1074879141 10:117638905-117638927 TGGAAAGTACTGAAAATGGAAGG - Intergenic
1077703436 11:4462251-4462273 TCTGAACTGCTGAAAAGGGGTGG + Intergenic
1079344457 11:19639833-19639855 TGGGAAGTGGAGAAAATGTGGGG + Intronic
1079457053 11:20645472-20645494 TGGGAAATCCTGAGAACAGGAGG + Intronic
1079466128 11:20732622-20732644 TGGGAAAGGCTGAGAAGTGGGGG + Intronic
1079884712 11:25972778-25972800 TAGGCAATGATGGAAATGGGTGG - Intergenic
1080716807 11:34810482-34810504 TGGGGAATGGTGATAAAGGGAGG + Intergenic
1080849254 11:36054132-36054154 TCTGAAATGCAGAAAATGGGGGG - Intronic
1081922837 11:46794895-46794917 TGGAAGAAGCTGAGAATGGGAGG + Intronic
1083107922 11:60376402-60376424 TGTAAAATGCTGAAGTTGGGGGG + Intronic
1083377608 11:62238522-62238544 TTGGAATTGCTGCAAATGAGAGG + Intergenic
1085887094 11:80533646-80533668 AGGGAAATGCTGAGAAGGGAAGG - Intergenic
1087081159 11:94172293-94172315 TGAGAAATGGTGTAGATGGGTGG - Intronic
1087235339 11:95711917-95711939 TGGTGGATGCTGAAAATGGCTGG + Intergenic
1087797240 11:102467347-102467369 TGAGATGAGCTGAAAATGGGAGG + Exonic
1088196771 11:107282413-107282435 GGGGAAATTCTGGAAATGTGTGG + Intergenic
1088397570 11:109385385-109385407 TGGGGGATGTTGATAATGGGAGG - Intergenic
1088729595 11:112669263-112669285 GGGGAATTGCTTAAAGTGGGTGG - Intergenic
1088999104 11:115034392-115034414 TATGAAATGGTGAAAATGAGTGG + Intergenic
1094184341 12:27625300-27625322 TGATAATTGTTGAAAATGGGTGG - Intronic
1094767213 12:33610766-33610788 TGGGAAAAGCTAAAAATCGTTGG - Intergenic
1096711607 12:53461154-53461176 AGGCTCATGCTGAAAATGGGGGG + Intronic
1097380768 12:58893511-58893533 TGGGAAATGGTCAAAATCAGAGG - Intronic
1097643419 12:62208161-62208183 TGAAAAATTCTGAAAATAGGAGG + Intronic
1099375956 12:81896705-81896727 ACAGAAATGCTGAACATGGGAGG + Intergenic
1100591718 12:96035837-96035859 AGGGAAATGATGAGAATGGAGGG + Intronic
1102822878 12:115923390-115923412 TGGGAAAAGCTGTTACTGGGAGG - Intergenic
1103131846 12:118475852-118475874 AGGGAAATGCAGAAAATGCTTGG + Intergenic
1103232005 12:119339235-119339257 TGGAAAAGGCTGAAAAAGAGAGG + Intronic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1106164829 13:27234881-27234903 TGGGAAAAGATGAAAATGGAAGG - Intergenic
1106588579 13:31078731-31078753 TGAGAAGTGTTGAAGATGGGAGG + Intergenic
1106686133 13:32061208-32061230 TGTTAAATGCTGAGTATGGGAGG + Intronic
1110779415 13:79447583-79447605 GAGGAAAGGGTGAAAATGGGAGG - Intergenic
1111743355 13:92233311-92233333 TGTGAAATGCTGAAAACTGCAGG - Intronic
1112632287 13:101175416-101175438 TGGGAAATTCTGAATATGGAGGG + Intronic
1112724655 13:102289287-102289309 TGGGAAATGCTGGGAATGAATGG - Intronic
1112795207 13:103049318-103049340 TGGAAAATGCTGTAGATGAGCGG + Exonic
1113376594 13:109770001-109770023 TGGCAAAAGGTGAGAATGGGAGG + Intronic
1113521832 13:110947006-110947028 TGGCAAAGTCTGAACATGGGGGG + Intergenic
1113555897 13:111234239-111234261 TGGGAAACGGTGAAAAGGTGTGG + Intronic
1115223373 14:31079396-31079418 TGGGGAATGCTGATCATGGGAGG + Intronic
1116721896 14:48507692-48507714 GTGGAAATGCTGTAAATGAGAGG + Intergenic
1117233400 14:53745667-53745689 TGGGAAAGGCTGAAAATGGGAGG + Intergenic
1117571447 14:57052795-57052817 AGGGAGATTTTGAAAATGGGGGG + Intergenic
1117952790 14:61099630-61099652 TGGGTAATTCTGAAAGTGGGTGG - Intergenic
1118323177 14:64765105-64765127 TGAGAAGGGCTGAAAAAGGGAGG + Intronic
1118520218 14:66575227-66575249 TGAAAAATGCTGAAAGTGAGAGG - Intronic
1119586717 14:75842690-75842712 TGGAAAAAGTAGAAAATGGGTGG + Intronic
1119891116 14:78183009-78183031 TGGGTAATGCTAACAATGGCAGG + Intergenic
1119950262 14:78737606-78737628 TGGGAAATGGCAAAAAAGGGGGG + Intronic
1122766343 14:104073699-104073721 TGGGAGATGATGGAACTGGGTGG + Intergenic
1124150552 15:27174344-27174366 TATGAAATGCAGAAAATGTGGGG - Intronic
1124983648 15:34584732-34584754 TGGGAAGTTCTGAAGACGGGGGG + Intronic
1125413642 15:39430276-39430298 GAGGAAATGGAGAAAATGGGGGG + Intergenic
1125431346 15:39597310-39597332 TGGCAAATAGTAAAAATGGGAGG - Exonic
1125864271 15:43029683-43029705 AGGGAACTTCTGAAACTGGGTGG - Intronic
1126146192 15:45474972-45474994 TGGGAAAGGCTGGAACTGCGGGG + Intergenic
1126408336 15:48345929-48345951 TGGGGGATGCTGATAATGGAGGG - Intergenic
1126992340 15:54394219-54394241 GGGGGACTGTTGAAAATGGGTGG - Intronic
1128061156 15:64736799-64736821 AGGGAAAGGTGGAAAATGGGAGG - Intergenic
1128443125 15:67731891-67731913 TGAGAAATGCTGAGCATTGGAGG + Intronic
1129902919 15:79165469-79165491 GGGGAAATGAGGAGAATGGGGGG + Intergenic
1129903515 15:79169936-79169958 TGGGAAATTCTGAGAAGGGCAGG - Intergenic
1130300706 15:82678180-82678202 TTGGAGAGGCAGAAAATGGGTGG + Intronic
1130684671 15:86026206-86026228 TGGGAAAGGAGAAAAATGGGAGG + Intergenic
1130795281 15:87202167-87202189 TGGGAAATGTTGAGCATGAGGGG - Intergenic
1131313354 15:91310699-91310721 TGGGGGATGTTGATAATGGGGGG - Intergenic
1132821773 16:1876425-1876447 TTGGCAATGCTGCAAATGGCTGG - Intronic
1135945955 16:26865179-26865201 TGGTATATGCTGAAAATAGAAGG + Intergenic
1138096660 16:54217215-54217237 TGAGGAATGCTGAAAAGTGGAGG + Intergenic
1138349490 16:56338901-56338923 GGGGAAATGGGGAAAAAGGGAGG - Intronic
1138618493 16:58192200-58192222 TAGGAAGTGCTGTAAATGAGAGG - Intronic
1139275949 16:65727839-65727861 TGGGAAATACTGGAGCTGGGAGG - Intergenic
1139777271 16:69324323-69324345 TGGGCAATGGTGAAGGTGGGAGG + Exonic
1139910344 16:70393755-70393777 TGGGAAATGGTGCAAGTGGGAGG - Intronic
1140226892 16:73085231-73085253 TTGTAAATGCTGTAAATGTGTGG - Intergenic
1140732526 16:77869684-77869706 TGGAAAATGCTCGAAGTGGGTGG - Intronic
1142143758 16:88484076-88484098 AGGGAAAGGCAGAAGATGGGAGG - Intronic
1142871323 17:2823063-2823085 TGAAAAATGCTGTAAATGGGTGG + Intronic
1143187411 17:5018926-5018948 TGGGAAATGAAGAAAAGGTGGGG + Intronic
1143214626 17:5215200-5215222 TGGAAATGGCTGAAAATGAGGGG + Intronic
1145774584 17:27519115-27519137 TGGGTAATGGTGACAGTGGGAGG + Intronic
1149115030 17:53083403-53083425 TGGTCAATGCTGCAAATGTGTGG - Intergenic
1149389588 17:56175644-56175666 TGGGGAATGGTGGAAATGGATGG - Intronic
1150315131 17:64162874-64162896 TGGTGAATGCAGAAAAAGGGAGG - Intronic
1150706717 17:67493672-67493694 TTGGAAATACTGGAAAGGGGAGG + Intronic
1152939944 17:83163446-83163468 TGGGAAATATTGATAAGGGGAGG - Intergenic
1153693946 18:7621401-7621423 TGGGAGCTGTTGATAATGGGGGG - Intronic
1154424528 18:14261850-14261872 TGGGGATTGGGGAAAATGGGTGG + Intergenic
1154973856 18:21437966-21437988 TGGTAAATGTTGAAATTGGATGG + Intronic
1154974000 18:21439127-21439149 TGGTAAATGTTGAAATTGGATGG + Intronic
1156190837 18:34718647-34718669 TGGAAAATGCAGAAAAATGGTGG + Intronic
1157433959 18:47653108-47653130 AGGCAAATGCTGGAAATGGTGGG + Intergenic
1157808796 18:50678639-50678661 TGGGAATTATTGAAAAAGGGAGG - Intronic
1157837912 18:50924981-50925003 TGGGGAGTGGGGAAAATGGGGGG - Intronic
1158459046 18:57631859-57631881 TGGGGAATCCAGAAGATGGGTGG - Intergenic
1159828753 18:73247543-73247565 TGTGAAGTGTTGAGAATGGGAGG + Intronic
1163202195 19:15777457-15777479 TGGGGGCTGCTGAGAATGGGGGG - Intergenic
1164124918 19:22304422-22304444 TGGAAATTGCTGAAATTGAGTGG + Intronic
1164248692 19:23457883-23457905 TGGGTAAAGATCAAAATGGGAGG - Intergenic
1164846947 19:31440301-31440323 TGGGCTATGCATAAAATGGGAGG + Intergenic
1165071716 19:33259652-33259674 AGGGAGATGGTGAAACTGGGAGG - Intergenic
1165922786 19:39308975-39308997 TGGGGCATGCAGAAAAGGGGAGG - Intronic
1166176308 19:41074005-41074027 AGGGAAATGCCCAAAATGGGGGG - Intergenic
1167422727 19:49413588-49413610 TGGGAAGAGCTGAGATTGGGCGG + Intronic
1167824680 19:51961405-51961427 GGAAAAATGCAGAAAATGGGGGG + Intergenic
926660813 2:15464028-15464050 TGGCGCATGCTGAAAATGGTTGG + Intronic
927357286 2:22187793-22187815 TGGGAAATTTTGCAAATGGAAGG + Intergenic
927525512 2:23736612-23736634 TGAGCAATGCAGAAGATGGGTGG + Intergenic
927859122 2:26549524-26549546 TGAGAAATGGGGAAAATGGAAGG - Intronic
929099728 2:38300177-38300199 AGAGAAATGCTGAAAATGGGGGG - Intronic
929882292 2:45847576-45847598 TGGGAGATGGTGAAATTGAGAGG + Intronic
931132817 2:59357076-59357098 TGGGAAATACTGATAATTGTAGG + Intergenic
931200638 2:60094287-60094309 TGGGCAATGCTGAAAATCTTTGG - Intergenic
931486827 2:62702425-62702447 TGGGCAATCCTGGAAGTGGGAGG + Intronic
934634517 2:95971381-95971403 TGGGAGATATTGATAATGGGGGG + Intronic
934799116 2:97133854-97133876 TGGGAGATATTGAAAATGGGGGG - Intronic
934834322 2:97569612-97569634 TGGGAGATGTTGAAAATGGGGGG + Intronic
935022290 2:99243322-99243344 TGGGAGATGCTGAACTTGAGGGG + Intronic
935709817 2:105888417-105888439 TAGGAAATGCGGACAGTGGGAGG + Intronic
936328375 2:111525033-111525055 TGGGATATGCAGAAAAATGGTGG + Intergenic
936864317 2:117059167-117059189 GGGGAAATGAAGAAAATGGAAGG - Intergenic
937686076 2:124698792-124698814 TGGGAAATCCTCAGAGTGGGAGG - Intronic
938582727 2:132661728-132661750 TGGGAAAAGGGGAAAATGAGGGG + Intronic
939687419 2:145216006-145216028 TGGTTAATGCTGAAAATCTGTGG + Intergenic
940653083 2:156456764-156456786 TAGGGAATGCTGGAAAGGGGAGG + Intronic
940972978 2:159913689-159913711 TGGCTAATGCTGAACCTGGGGGG + Intergenic
943339369 2:186660494-186660516 AAGGAAATGATGAAAATGGTGGG - Intronic
945029153 2:205647518-205647540 TGAGTAATGGTGAAAATGGAAGG - Intergenic
945876156 2:215280063-215280085 GGGGAAAAGGTGAAAATGGATGG - Intergenic
947129024 2:226902742-226902764 TGGAAAATGCTGAATGTTGGAGG + Intronic
947846355 2:233247060-233247082 TGGGAAGAGCTGAAAAGGAGTGG + Intronic
948316194 2:237030312-237030334 TGGGATGTGCTGAAAAGGCGTGG + Intergenic
1170138046 20:13097156-13097178 TGGGAATTGCATAAAATGGATGG + Intronic
1171426586 20:25052353-25052375 TGGGAAAGGCCGGAAATAGGAGG - Intronic
1172586398 20:36088272-36088294 TGAGAATTGCTGAACCTGGGAGG - Intergenic
1173116744 20:40250997-40251019 TGGGAATTGTGGAAAATGTGGGG + Intergenic
1175664575 20:60847526-60847548 TGGGAAATGGAGAAAAATGGTGG - Intergenic
1175751519 20:61501394-61501416 TGGGAAATGCTGAAAAGTGTTGG + Intronic
1177232721 21:18343155-18343177 TGTGAAAAGCTGAAAATTGTAGG + Intronic
1177798599 21:25805393-25805415 TGGCAGATGCTGAAAATTGCAGG + Intergenic
1178276841 21:31246542-31246564 AGGAAAATGGTGAAAATGGACGG - Intronic
1178473402 21:32915751-32915773 ACAGAAATGCTGAAAATGTGGGG + Intergenic
1179398159 21:41060132-41060154 AAGGAAATGCTGAAAAGGGAGGG - Intergenic
1179503729 21:41825794-41825816 TGGCAAGTGTTTAAAATGGGTGG + Intronic
1185266908 22:49909073-49909095 TGGGAAATGCTGGCCATGGGAGG - Intronic
949333684 3:2950240-2950262 TGGGAGTTGCTGAAATTTGGAGG + Intronic
949932724 3:9091823-9091845 AGGGAAAGGAAGAAAATGGGAGG - Intronic
949956303 3:9271520-9271542 TGGGAAGTTCTGAAACCGGGAGG - Intronic
950362416 3:12459034-12459056 TGGGAAATCCTGAAACTGGGAGG + Intergenic
950679638 3:14576005-14576027 TGGCCAGTGCTGGAAATGGGAGG + Intergenic
951050625 3:18089351-18089373 TGGGAAATTCTGAACTTTGGTGG + Intronic
951467477 3:23017827-23017849 TGTGAAATGCTGAGTATGTGTGG - Intergenic
953261611 3:41344660-41344682 TGAGAAATGCTTAAACTCGGGGG + Intronic
955054677 3:55444843-55444865 TGGGTAACTCTGAACATGGGAGG + Intergenic
957413192 3:79866917-79866939 TGGTAACTGCTGGAAATGTGAGG - Intergenic
958678291 3:97293894-97293916 TGGGAACTGATGAACACGGGAGG - Intronic
958981498 3:100725701-100725723 TGAGAATTGCTGAACCTGGGAGG + Intronic
959656958 3:108818328-108818350 TGGCCAATGAGGAAAATGGGTGG + Intergenic
960711117 3:120529377-120529399 AGAGAAATGTTGAAAATGGAAGG - Intergenic
963656188 3:148053956-148053978 TGGGAGATGTTGATAATGAGGGG + Intergenic
963805098 3:149714555-149714577 TGGGAACTAATGAACATGGGAGG + Intronic
964210385 3:154220369-154220391 TGGAAAATACTGGAAATGGAAGG + Intronic
966458963 3:180153651-180153673 TGGGAAGTACAGAAAGTGGGAGG - Intergenic
968177371 3:196562642-196562664 GGGGAAATGGTGAAAATGGCAGG + Intronic
968281302 3:197478852-197478874 TGGGAGGAGCTGAAAATGAGGGG + Intergenic
968883021 4:3310753-3310775 TGGGACATGATGACTATGGGAGG + Intronic
969041923 4:4305361-4305383 AGGGAAATGGAGAAAATGAGAGG + Intronic
969508761 4:7605188-7605210 TGGGATATGCAGACAATGGCTGG - Intronic
970872728 4:20834686-20834708 TGGGAAATGCTGGAAAAGCATGG + Intronic
970907141 4:21229151-21229173 TGGGAAATGATGATGATGTGGGG - Intronic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
973059325 4:45700808-45700830 TGGGAAAAGCTGAAAATGAGGGG - Intergenic
973989483 4:56389720-56389742 TGGGGAATGTGGAAGATGGGTGG - Intergenic
977112865 4:92982158-92982180 TGTGAAATGGTCAAAATGAGAGG + Intronic
981701512 4:147612222-147612244 TGGGCAAGCCTGAAAATGTGGGG + Intergenic
982768270 4:159372364-159372386 TGGGAGATGCTGACAATGCAGGG + Intergenic
983232628 4:165144847-165144869 TGGGAAATGCTGTCACTAGGTGG - Intronic
984568080 4:181355327-181355349 TGAGAAATGATGAAAATGGGTGG - Intergenic
987468499 5:18301465-18301487 TGGGAAATACTAGAAAGGGGAGG - Intergenic
993538530 5:89119022-89119044 GGGGAAATGGGGAAGATGGGAGG + Intergenic
993980466 5:94538487-94538509 TGGGAAATGCTGCCACTGGCTGG + Intronic
995224061 5:109684371-109684393 TGGGAAGTGGAGGAAATGGGGGG - Intergenic
995531157 5:113093141-113093163 TAGGACATGCACAAAATGGGGGG + Intronic
995540783 5:113183910-113183932 TGGGGAATTGTGAAGATGGGTGG - Intronic
995565863 5:113433010-113433032 TGGCAACTGGAGAAAATGGGAGG - Exonic
996217607 5:120888337-120888359 TGGGAAGTGCTGGAAAGTGGAGG + Intergenic
996954830 5:129170251-129170273 TTAGAAATGCAGAATATGGGTGG - Intergenic
997213835 5:132094542-132094564 TGGGGAATGCTCAGAAGGGGAGG - Intergenic
997680385 5:135746187-135746209 TGGAAAAGGCTGCACATGGGAGG - Intergenic
998133043 5:139660703-139660725 TGGGAATTGGTGAACATGGGGGG + Intronic
998737968 5:145164670-145164692 TGTCTAATGCTGAAAGTGGGAGG + Intergenic
999785057 5:154883306-154883328 TCCGAACTGCTGAAAAGGGGTGG + Intergenic
1004039690 6:11963256-11963278 TGGGGGATGCTGAAAATGGTGGG - Intergenic
1007177871 6:39909084-39909106 TGGGAAATACTGAACATGCCTGG + Exonic
1007384575 6:41512000-41512022 TGGGGAATCTTGAAAGTGGGAGG + Intergenic
1007631538 6:43275774-43275796 TGGGAAGAGCTGGAAATGGGGGG - Intronic
1007786920 6:44285916-44285938 TGAGAGATGCTGAGAAGGGGTGG + Intronic
1008154995 6:48002842-48002864 GGGGGAATGCTGAAAATGAAAGG - Intronic
1008685558 6:53922511-53922533 TTAGAAATTCTTAAAATGGGTGG - Intronic
1010312488 6:74403712-74403734 TGGGAAATGTTGACAAAGGCAGG + Intergenic
1010846126 6:80710549-80710571 TGGGAAATGCAGGATCTGGGTGG + Intergenic
1013257707 6:108405779-108405801 TGGGAAAGGGGGACAATGGGTGG - Intronic
1014033377 6:116736353-116736375 TGGGGAAAGTTGGAAATGGGAGG + Intronic
1014331972 6:120079501-120079523 TGGGAGATGTTGATATTGGGGGG - Intergenic
1014348077 6:120300967-120300989 AGAGAAAGGCTGAAAATGGGAGG - Intergenic
1014489524 6:122044931-122044953 TGGGAGATGGTGAAAAAGGAGGG + Intergenic
1014616018 6:123600487-123600509 TGGACAATGGAGAAAATGGGTGG + Intronic
1014622249 6:123682616-123682638 TGAGAAATGCTGAAGAAGGTTGG + Intergenic
1015223353 6:130829559-130829581 AGGGAAGTGCTGAAGATAGGAGG - Intronic
1015577636 6:134689967-134689989 TGAGAGATGCTGCAAGTGGGAGG + Intergenic
1015622557 6:135146870-135146892 TGTTTAATGCTGAGAATGGGAGG + Intergenic
1016298031 6:142597023-142597045 TTGGAAATACCTAAAATGGGAGG + Intergenic
1017797893 6:157864306-157864328 TGGGAGGTGCGGCAAATGGGGGG - Intronic
1018550091 6:164986389-164986411 TAGGAAATGTTGAAATAGGGTGG + Intergenic
1019328592 7:451917-451939 TGGGAAAATCAGAAACTGGGCGG - Intergenic
1020051777 7:5086551-5086573 TGGGAGATGCCGGGAATGGGTGG + Intergenic
1021056268 7:16050154-16050176 TAGCAAAGGCTGAAAATTGGTGG + Intergenic
1024534050 7:50415592-50415614 TTGGAAATGCTGGAGATGGCTGG - Intergenic
1027556702 7:79672560-79672582 TGAGAAATACTGGAAATTGGGGG - Intergenic
1027956712 7:84887815-84887837 TGGGATCTGCCCAAAATGGGAGG - Intergenic
1028817399 7:95162686-95162708 TGTGTAATGATGAAAATGGTTGG + Intronic
1030208800 7:106976231-106976253 TAGGTAATGCTGAAAATTGATGG + Intergenic
1030841813 7:114362962-114362984 TGAGAAATGTTGAAAATGATAGG - Intronic
1032013958 7:128364413-128364435 CTGAAAATGCTGAAAATGAGGGG + Intergenic
1032539152 7:132688914-132688936 TGGGAGCTGCTGGAATTGGGAGG + Intronic
1034145617 7:148868625-148868647 TGGGAAAAGAAGAAAATGAGAGG + Intronic
1034777846 7:153847867-153847889 TGGGAAATCCCAGAAATGGGAGG - Intergenic
1036111231 8:5905117-5905139 TTGGAAATGCTGAAAAGGAATGG - Intergenic
1037211663 8:16395864-16395886 TTGGAATTGCAGAAAATGAGTGG - Intronic
1037967113 8:23143582-23143604 TAGGAAAGGAAGAAAATGGGTGG + Intronic
1039259626 8:35757312-35757334 TTGGAGATGATGAAAATGTGGGG - Intronic
1039376454 8:37039247-37039269 TGGGAAATTCTGAGAGTGGAAGG + Intergenic
1041417467 8:57627277-57627299 TGTGAAAAGCAGAAAATCGGTGG - Intergenic
1041454108 8:58039235-58039257 TGGGTTATGCTGAAAATGCAGGG + Intronic
1041677627 8:60551322-60551344 TGGCTAATGCTGAAAATGAATGG + Intronic
1042185386 8:66131655-66131677 TGGGAGAGGCTGAAAAGAGGAGG - Intronic
1042949557 8:74186790-74186812 TGGGAAAAACTAAAATTGGGAGG + Intergenic
1043038799 8:75232547-75232569 TGGAAGATGTTGATAATGGGGGG + Intergenic
1045357219 8:101399959-101399981 TGGGAGATGCTGAGCATGTGTGG - Intergenic
1046169240 8:110483729-110483751 TGGGAAATACTGAGAAGGTGTGG - Intergenic
1047570550 8:126094395-126094417 GGGGAAATGCTGGAACTGAGTGG - Intergenic
1048078661 8:131101168-131101190 TGGGAAATCCTGAGAAGTGGAGG + Intergenic
1048436616 8:134424399-134424421 TGGGAAATGGTGAGAAAGGCTGG - Intergenic
1049562998 8:143321395-143321417 TGGGGAATGGTCAAAGTGGGTGG + Intronic
1049931195 9:458502-458524 TGGGCTGTGCTGAAAAAGGGGGG + Intronic
1050481515 9:6092381-6092403 TGGGAACTACTAGAAATGGGAGG - Intergenic
1052786245 9:32831095-32831117 TCTGAAAAGCTGAAAATGGGAGG + Intergenic
1055158012 9:73088377-73088399 TGGGAAATGATGAGTATGTGAGG - Intergenic
1057448788 9:95138044-95138066 TGGGAAAGGCTGAAAAGCAGTGG + Intronic
1057750334 9:97787688-97787710 TGTGGAATGATGAGAATGGGTGG - Intergenic
1059873180 9:118601239-118601261 TGTGAATTGCTGAGAAAGGGTGG + Intergenic
1060064366 9:120490270-120490292 TGAAAAATGCTGACAATTGGGGG - Intronic
1060289570 9:122288670-122288692 TGGGATATGAAGAAAATGGAAGG + Intronic
1061319213 9:129817286-129817308 TGGGCAATGCAGAGAAAGGGAGG + Intronic
1062227608 9:135462169-135462191 TTGGGAATGCAGAAAAAGGGAGG - Intergenic
1062514843 9:136927628-136927650 TGGCAACTGCTAAAAAGGGGAGG - Intronic
1186458858 X:9732416-9732438 TGGGAAAAGCAGGAAATGGCGGG + Intronic
1186611475 X:11142112-11142134 TGGGAAATGCTGAAAATGGGAGG - Intronic
1187068692 X:15866327-15866349 AGGGAAAAGCTGAAGATGGGTGG + Intergenic
1187095364 X:16142357-16142379 TGGTAATTGCTGAATGTGGGTGG - Intronic
1188441592 X:30218983-30219005 GGAGAAATGCTGAAAATTGTTGG + Exonic
1190581304 X:51894683-51894705 TGGGGAATGCAGAAAGAGGGAGG - Exonic
1192133490 X:68574923-68574945 TGGGAAAGGCACAAAATGGGTGG - Intergenic
1195370807 X:104170366-104170388 TGAGACAAGTTGAAAATGGGGGG + Intronic
1196776318 X:119341143-119341165 TGGGAAATGACGATAATGGGAGG - Intergenic
1198511845 X:137360194-137360216 TGGGGAGTGGGGAAAATGGGGGG - Intergenic
1198860747 X:141066888-141066910 TGAGGAATGCTGAAAATGAAAGG - Intergenic
1198901945 X:141520498-141520520 TGAGGAATGCTGAAAATGAAAGG + Intergenic
1199061412 X:143359463-143359485 ATGGAAATGCTGAGAAGGGGTGG - Intergenic
1199697512 X:150353249-150353271 TGGAAAATGCTAGAAATGGGAGG + Intergenic
1200324102 X:155219671-155219693 TGGGAAATGCATAAAGTGGTGGG + Intronic
1202049816 Y:20768706-20768728 AAGGAAATGTTGAAAATTGGTGG + Intronic