ID: 1186611644

View in Genome Browser
Species Human (GRCh38)
Location X:11143771-11143793
Sequence GGACCCTCCCAGCCAACGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 395}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186611639_1186611644 10 Left 1186611639 X:11143738-11143760 CCAGATATCTGAGACTTGGAGTG 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1186611644 X:11143771-11143793 GGACCCTCCCAGCCAACGACTGG 0: 1
1: 0
2: 1
3: 13
4: 395
1186611638_1186611644 11 Left 1186611638 X:11143737-11143759 CCCAGATATCTGAGACTTGGAGT 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1186611644 X:11143771-11143793 GGACCCTCCCAGCCAACGACTGG 0: 1
1: 0
2: 1
3: 13
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186611644 Original CRISPR GGACCCTCCCAGCCAACGAC TGG Intronic
902042409 1:13502420-13502442 GAACCCTCCCAGCCAGTGCCTGG - Intronic
902638400 1:17750463-17750485 AGACCCTTCCAGCCCAAGACTGG + Intergenic
905981745 1:42235189-42235211 GGACCCTCCGAGCCAGGCACGGG + Intronic
906374578 1:45284903-45284925 GGACCCTCCCAGCCAGGCGCAGG - Intronic
906584548 1:46965025-46965047 GGACCCTCCAAGCCAGGCACAGG + Intergenic
906752431 1:48277529-48277551 GGACCCTCCGAGCCAAGTGCGGG - Intergenic
906753633 1:48288700-48288722 GGACCCTCCGAGCCAGGCACGGG - Intergenic
906755611 1:48311923-48311945 GGACCCTCCAAGCCAATCGCGGG - Intronic
908215089 1:61943447-61943469 GGACCCTCCAAGCCAGGCACAGG - Intronic
909274706 1:73668289-73668311 GGACCCTCCAAGCCAGGCACAGG + Intergenic
910930259 1:92436552-92436574 GGACCCTCCAAGCCACGCACGGG + Intergenic
910945680 1:92589470-92589492 GGACCCTCCAAGCCAGGCACAGG - Intronic
910949982 1:92635465-92635487 GGACCCTCCGAGCCAGGCACAGG + Intronic
913033114 1:114932756-114932778 GGACCCTCCCAGCCAGGCAAGGG - Intronic
913284996 1:117217935-117217957 GGACCCTCCGAGCCAGGCACAGG - Intergenic
913580777 1:120224783-120224805 GGACCCCCCAAGCCAAGCACGGG + Intergenic
914683469 1:149957822-149957844 GGACCCTCCGAGCCAGGCACGGG + Intronic
916249510 1:162723595-162723617 GGACCCACCCAGCCAATTAGAGG + Intronic
916460794 1:165022204-165022226 GGACCCTCCGAGCCAGGCACAGG + Intergenic
916543857 1:165783792-165783814 GGACCCTCCGAGCCATGCACGGG + Intronic
917207914 1:172597074-172597096 GGACCCTCCGAGCCATGCACGGG + Intronic
917684955 1:177406585-177406607 GGACCCTCCCAGCCAGGTGCAGG + Intergenic
918554647 1:185784139-185784161 GGACCCTCCAAGCCAGGCACAGG + Intronic
918593159 1:186262377-186262399 GGACCCTCCAAGCCAGGCACGGG + Intergenic
919603165 1:199647666-199647688 GGACCCTCCGAGCCATGCACGGG - Intergenic
920388875 1:205586496-205586518 AGCCCATCCCAGCCAACAACTGG + Intronic
922393140 1:225168505-225168527 GGACCCTCCAAGCCAGGCACTGG - Intronic
1062797088 10:352681-352703 TGTCCCTCCCAGCCAACGGTGGG - Intronic
1065593002 10:27284679-27284701 GGACCCTGCCAGCCACCCCCTGG - Intergenic
1066060489 10:31719464-31719486 GGACCCTCCGAGCCAGGAACGGG + Intergenic
1066274302 10:33853532-33853554 GGACCCTCCAAGCCATGCACGGG + Intergenic
1066608445 10:37208479-37208501 GCAACCTCCCAGCCAACAAATGG - Intronic
1068821243 10:61379147-61379169 GGACCCTCCCAGCCATGTGCAGG + Intergenic
1069161673 10:65100978-65101000 GGACCCTCCAAGCCAGCTGCAGG - Intergenic
1069325880 10:67231000-67231022 GGACCCTCCCAGCCAGGTGCGGG - Intronic
1070455305 10:76608853-76608875 GGACCCTCCGAGCCAGGCACGGG - Intergenic
1071323774 10:84491526-84491548 GGACCCTCCGAGCCAGGCACAGG + Intronic
1071748023 10:88443669-88443691 GGACCCTCCAAGCCATGCACGGG - Intronic
1072029360 10:91503603-91503625 GGACCCTCCGAGCCAAGTGCGGG - Intronic
1072719797 10:97773304-97773326 GTACCCTCCCCACCAAAGACTGG - Intergenic
1073661473 10:105480815-105480837 GGACCCTCCCAGCCATGTGCGGG + Intergenic
1077697376 11:4406578-4406600 GGACCCTCCAAGCCAGGCACGGG + Intergenic
1077834603 11:5914822-5914844 GGACCCTCCAAGCCAAGCGCGGG - Intronic
1077857540 11:6143985-6144007 GGACCCTCCCAGCCAGGTGCCGG - Intergenic
1079037571 11:17034293-17034315 GGACCCTCCGAGCCAGGCACGGG + Intergenic
1079174734 11:18128564-18128586 GGACCCTCCGAGCCAGGCACAGG + Intronic
1079242357 11:18729633-18729655 GGGTCCTCCCAGCCAGCCACTGG - Intronic
1079457456 11:20649416-20649438 GGCCAGTCCCAGCCAAGGACAGG + Intronic
1080059211 11:27939407-27939429 GGACCCTCCGAGCCAAGTGCGGG - Intergenic
1080150898 11:29051071-29051093 GGACCCTCCGAGCCAGGCACAGG - Intergenic
1081169253 11:39846994-39847016 GGACCCTCCCAGCCATGTGCGGG - Intergenic
1081405045 11:42688360-42688382 GGACCCTCCAAGCCAGGCACTGG - Intergenic
1082273719 11:50199548-50199570 GGACCCTCCGAGCCATGCACGGG + Intergenic
1082577967 11:54833015-54833037 GGACCCTCCAAGCCAGGGGCGGG + Intergenic
1083184610 11:61009843-61009865 GGACCCTGGCTGCCAGCGACTGG - Exonic
1086409124 11:86526223-86526245 GGACCCTCCGAGCCATGCACGGG - Intronic
1086548529 11:88027572-88027594 GGACCCTCCCAGCCAGTTGCGGG - Intergenic
1087503956 11:98996783-98996805 GGACCCTCCAAGCCAGGCACGGG - Intergenic
1087580150 11:100040762-100040784 GGACCCTCCTAGCCAAGTGCGGG + Intronic
1087598706 11:100286081-100286103 GGACCCTCCCAGCCAGGTGCGGG - Intronic
1087860017 11:103141999-103142021 GGACCCTCCCAGCCATGTGCAGG + Intronic
1088300922 11:108357270-108357292 GGACCCTCCAAGCCAGCTGCGGG - Intronic
1092718457 12:11416508-11416530 GGACCCTCCGAGCCATGCACGGG - Intronic
1093275152 12:17116639-17116661 GGACCCTCCAAGCCAAGCATGGG - Intergenic
1093802312 12:23389021-23389043 GGACCCTCCGAGCCAAATGCAGG - Intergenic
1094792225 12:33928602-33928624 GGACCCTCTGAGCCAGGGACAGG - Intergenic
1095033436 12:37323547-37323569 GGACCCTCCCAGCCAGGTGCCGG + Intergenic
1095103749 12:38207548-38207570 GGACCCTCCGAGCCATGCACAGG - Intergenic
1095133362 12:38568884-38568906 GGCTGCTCCCAGCCAAAGACTGG + Intergenic
1095913950 12:47457585-47457607 GGACCCTCCGAGCCATGCACGGG + Intergenic
1096030545 12:48410229-48410251 GGACCCACCCAGCCAAGCACAGG + Intergenic
1096954369 12:55510488-55510510 GGACCCTCCAAGCCAGACACGGG + Intergenic
1098057308 12:66521856-66521878 GGACCCTCCAAGCCAGGTACGGG - Intronic
1098494464 12:71118411-71118433 GGACCCTCCCAGCCAGGTGCCGG - Intergenic
1098692304 12:73503846-73503868 GGACCCTCCAAGCCAGGCACAGG + Intergenic
1100907799 12:99321491-99321513 GGACCCTCCGAGCCAAGTGCCGG + Intronic
1100919249 12:99463640-99463662 GGACCCTCCGAGCCATGCACAGG - Intronic
1101029079 12:100642605-100642627 GGACCCTCCAAGCCAGGCACAGG + Intergenic
1101401771 12:104394344-104394366 GGACCCTCCGAGCCAGGCACGGG + Intergenic
1102423211 12:112820458-112820480 TTACCCACCCAGCCAGCGACCGG - Intronic
1104943089 12:132403974-132403996 GGAAGCTCCCAGCCCACGACAGG + Intergenic
1104966022 12:132509185-132509207 GGCCGCTCCCAGCCAGCCACTGG + Intronic
1105420002 13:20243612-20243634 GGACCCTCCGAGCCAGGCACGGG - Intergenic
1106079413 13:26488004-26488026 GTTCCCTCCCAGCCCACGCCTGG - Intergenic
1106617252 13:31340927-31340949 GGACCCTCCGAGCCAGGCACGGG - Intergenic
1108230918 13:48339459-48339481 GGACCCTCCGAGCCAGGCACAGG + Intronic
1110180400 13:72610587-72610609 GGACCCTCCGAGCCAGGTACGGG - Intergenic
1110260651 13:73481255-73481277 GCAGCCTCACAGCCAAGGACAGG - Intergenic
1110729246 13:78860691-78860713 GGACCCTCCGAGCCAGGCACGGG + Intergenic
1110729718 13:78866208-78866230 GGACCCTCCGAGCCAGGGGCAGG - Intergenic
1110892568 13:80708266-80708288 GGACCCTCCGAGCCAGGCACAGG + Intergenic
1112412059 13:99173112-99173134 GGACCCGCCCAGCCAGGCACGGG + Intergenic
1113737165 13:112687231-112687253 GGACAATCCCAGCCAACAACAGG + Intergenic
1114240262 14:20860453-20860475 GGACCCTCCAAGCCAGGCACGGG - Intergenic
1114425777 14:22621402-22621424 GGACCCTCCAAGCCAGGCACGGG + Intergenic
1114691587 14:24587472-24587494 GGACCCTCCAAGCCAGGCACAGG + Intergenic
1115077936 14:29414086-29414108 GGACTCTCCCAGCCAGGCACGGG - Intergenic
1115412184 14:33088392-33088414 GGACCCTCCGAGCCAGGCACGGG - Intronic
1115477068 14:33825811-33825833 GGACCCTCCCAGCTAGGGGCGGG - Intergenic
1116540983 14:46101186-46101208 GGACCCTCCGAGCCATGCACGGG + Intergenic
1116711355 14:48372042-48372064 GGACCCTCCCAGCCAGGCGCAGG + Intergenic
1117193703 14:53318381-53318403 GGACCCTCCGAGCCAGGCACGGG - Intergenic
1117349880 14:54870703-54870725 GGACCCTCCGAGCCAAGCGCAGG - Intronic
1117511369 14:56454790-56454812 GGACCCTCCAAGCCATGCACAGG - Intergenic
1117807884 14:59513521-59513543 GGACCCTCCAAGCCAGGCACGGG - Intronic
1118483372 14:66189515-66189537 GGACCCTCCCAGCCAGGCACGGG + Intergenic
1118938513 14:70310862-70310884 GGACCCTCCCAGCCAGGCATGGG + Intergenic
1119100799 14:71878470-71878492 GGACCCTCCAAGCCAGGCACGGG + Intergenic
1122409661 14:101519314-101519336 AGTCCCTCCCAGCCAGCCACGGG - Intergenic
1123822352 15:24043535-24043557 GGACCCTCCAAGCCAGGCACAGG - Intergenic
1123949387 15:25255932-25255954 GGACCCTCCAAGCCAGGCACGGG - Intergenic
1124570004 15:30854392-30854414 GGACCCTCCAAGCCAGGCACGGG + Intergenic
1126542514 15:49839005-49839027 GGACCCTCCGAGCCATGCACGGG + Intergenic
1128377296 15:67086298-67086320 GGATGCTCTCAGCCAAAGACAGG - Intronic
1129796528 15:78381737-78381759 GGACCCTCTGAGCCAAGCACGGG + Intergenic
1131555587 15:93395741-93395763 GGACCCTCCCAGCCATGCACAGG + Intergenic
1132139744 15:99382317-99382339 GGACCCTCCCAGCCAGGCATGGG + Intronic
1132218292 15:100084197-100084219 GGACCCTCCCAGCCATGCGCGGG - Intronic
1132594856 16:744032-744054 GCAACCTCCCACCCAACCACCGG - Intronic
1133014988 16:2935550-2935572 GGACCGGCCCAGGAAACGACGGG - Intronic
1134662737 16:15996591-15996613 GGACCCAGCCAGCCAACTCCAGG - Intronic
1134879561 16:17733496-17733518 GGACCCTCCGAGCCAGGCACGGG - Intergenic
1134897949 16:17906756-17906778 GGACCCTCCGAGCCAGGCACGGG - Intergenic
1134930026 16:18199428-18199450 GGATCTTCCCAGCCAGTGACTGG + Intergenic
1136930800 16:34416477-34416499 GGACCCTCCAAGCCATGCACGGG + Intergenic
1136973773 16:34995331-34995353 GGACCCTCCAAGCCATGCACGGG - Intergenic
1137317942 16:47347399-47347421 AGACCCTCCCAGCCATGCACAGG - Intronic
1140168748 16:72581125-72581147 GGACCCTCCGAGCCAGGCACGGG - Intergenic
1140179107 16:72696165-72696187 GGACCCTCCGAGCCAGGCACGGG + Intergenic
1144929957 17:18851158-18851180 GGTCTCTCCCTGCCAAAGACAGG - Intronic
1145396775 17:22502720-22502742 GGACCCTCCGAGCCAGGGGCAGG + Intergenic
1147189649 17:38731018-38731040 GGATCCTTCCAGCCTACGGCAGG - Intronic
1148953213 17:51332735-51332757 GGACCCTCCCAGCCAGGTGCGGG + Intergenic
1149961085 17:61110568-61110590 GGACCCTCCCAGCCAGGTGCGGG - Intronic
1150806605 17:68324394-68324416 GGACCTTCCCAGCCAAAGACTGG + Intronic
1153568782 18:6447261-6447283 AGACCCTCCCAGCCACCCACAGG - Intergenic
1154320677 18:13348858-13348880 GGACCCTCCGAGCCAGGCACGGG + Intronic
1154413923 18:14162994-14163016 GGACCCTCCAAGCCAGGCACGGG - Intergenic
1156280029 18:35627923-35627945 GGACCCTCCGAGCCAGGCACGGG - Intronic
1156433423 18:37100375-37100397 GGACCCTCCGAGCCAGGCACAGG - Intronic
1157632090 18:49108192-49108214 GGACCCTCCGAGCCAGGCACGGG + Intronic
1158647126 18:59256985-59257007 GGACCCTCCAAGCCAGGCACGGG - Intergenic
1159099340 18:63940706-63940728 GGACCCTCCCAGCCAGTCGCGGG - Intergenic
1159810876 18:73016775-73016797 GGACCCTCCAAGCCAGGCACAGG - Intergenic
1160683687 19:423741-423763 TCCCCCTCCCAGCCAGCGACTGG + Intronic
1161461826 19:4402440-4402462 AGCTCCTCCCAGCCAATGACAGG + Intergenic
1161521912 19:4729440-4729462 GGACCGTCCTAGCCAAAGCCAGG - Intergenic
1164294294 19:23896097-23896119 GGACCCTCCGAGCCAGGCACGGG + Intergenic
1166718817 19:44985962-44985984 GGACCCTTCCGGCCACCGACAGG - Intronic
1166936903 19:46339581-46339603 GGCCCCTTCCAGCCAAGGGCAGG + Exonic
925172747 2:1760268-1760290 GGACCCTCCGAGCCAGGCACAGG - Intergenic
926568782 2:14507249-14507271 GGACCCTCCCAGCCAGGTGCGGG + Intergenic
926794066 2:16604397-16604419 GGCTCCTCCCAGCCATCGTCTGG + Intronic
928765026 2:34635648-34635670 GGACCCTCCCAGCCATGTGCGGG - Intergenic
928852510 2:35766790-35766812 GGACCCTCCGAGCCAGGCACGGG - Intergenic
929295155 2:40238271-40238293 GGACCCTCCCAGCCAGGTGCGGG + Intronic
929958343 2:46477763-46477785 GGACCCTCCAAGCCAGGAACAGG + Intronic
931950488 2:67356406-67356428 GGACCCTCCCAGCCAGGTGCGGG - Intergenic
931977047 2:67654403-67654425 GGACCCTCCCAGCCAGGTGCAGG - Intergenic
932478119 2:72021611-72021633 GGACCCTCCCAGCCAGGTGCAGG + Intergenic
934550401 2:95257854-95257876 GGACCCTCCAAGCCATGCACGGG + Intronic
934997426 2:98978161-98978183 GGACCCTCCCAGCCAGGCACAGG - Intergenic
936155743 2:110046551-110046573 GGACCCTCCCAGCTCACTCCAGG + Intergenic
936188945 2:110324882-110324904 GGACCCTCCCAGCTCACTCCAGG - Intergenic
937186784 2:120051441-120051463 GGACCCTCCGAGCCAGGCACAGG + Intronic
937507229 2:122551076-122551098 GGACCCTCCAAGCCAAGTGCAGG - Intergenic
938147539 2:128849299-128849321 GGACCCTCTGAGCCAAGCACAGG - Intergenic
938156854 2:128949079-128949101 GGACCCTCCGAGCCATGCACGGG + Intergenic
938167502 2:129043895-129043917 GGACCCTCCGAGCCAGGCACGGG + Intergenic
939074902 2:137588120-137588142 GGACCCTCCGAGCCAGGCACGGG + Intronic
939179280 2:138785045-138785067 GGACCTTCTCAGGCAACAACTGG + Intergenic
940814030 2:158278476-158278498 GGACCCTCCCAGCCAGGTGCAGG - Intronic
941911815 2:170771191-170771213 AGACACTCCGAGGCAACGACCGG + Intergenic
942197193 2:173532959-173532981 GGACCCTCCCAGCCAGGTGCCGG + Intergenic
943549313 2:189319520-189319542 GGACCCTCCGAGCCAGGCACGGG - Intergenic
944106955 2:196089502-196089524 GGACCCTCCAAGCCATGCACGGG - Intergenic
944307707 2:198196587-198196609 GGACCCTCCGAGCCAGGCACAGG - Intronic
944600707 2:201300278-201300300 GGACCCTCCCAGCCATGCATGGG - Intronic
948170509 2:235898019-235898041 TGGCCCTCCCAGCCATCGAGGGG - Intronic
948915444 2:241032477-241032499 CGACCCCCCCACCCCACGACAGG - Intronic
948984188 2:241509804-241509826 GGACCATGCCAGCCCACGGCAGG + Intergenic
1168897452 20:1333615-1333637 GGACCCTGCCAGCCCTTGACGGG - Intronic
1171001350 20:21418928-21418950 CCACCCTCCCACCCCACGACAGG - Intergenic
1172320921 20:33994406-33994428 GGGCCCACCCAGCCAACTACTGG - Intronic
1174790450 20:53472982-53473004 GGACCCTCCCAGCCAGGTGCGGG - Intronic
1178340495 21:31782067-31782089 GGACCTTCTCAGCCAAGGAAAGG - Intergenic
1178722383 21:35021687-35021709 GGACCTACCCAGCCAGCCACAGG + Intronic
1179484056 21:41698292-41698314 GGACCCTCCGATCAGACGACGGG + Intergenic
1180170761 21:46057069-46057091 GGACCCTCCCTGCCCGTGACGGG + Intergenic
1180368252 22:11959726-11959748 GGACCCTCCGAGCCAGGTACAGG - Intergenic
1181168726 22:20996629-20996651 GCACCCTCCCAGGGAAGGACAGG - Intronic
1182089438 22:27584012-27584034 GGCCCCTCCCAGCCAGCCCCAGG + Intergenic
1185247442 22:49780650-49780672 GGACCCTCCCAGCCTCCACCTGG + Intronic
949912313 3:8922292-8922314 GGACCCTCCGAGCCAGGCACGGG - Intronic
950575843 3:13831692-13831714 GCAGCCCCCCAGCCAAAGACTGG + Intronic
950781583 3:15397270-15397292 GGACCCTCCGAGCCAGGCACGGG + Intronic
950919204 3:16676955-16676977 GGACCCTCCGAGCCAGGTACGGG - Intergenic
951286622 3:20821179-20821201 GTACCCTCCGAGCCAAGCACGGG + Intergenic
951684476 3:25328878-25328900 GGACCCTCCGAGCCAGGCACGGG - Intronic
951861998 3:27263603-27263625 GGACCCTCCGAGCCAGGCACGGG + Intronic
951964754 3:28369943-28369965 GGACCCTCCGAGCCAGGCACAGG + Intronic
952514937 3:34094414-34094436 GGACCCTCCGAGCCACACACGGG - Intergenic
953116162 3:39994393-39994415 GGACCCTCCGAGCCAGGCACGGG - Intronic
953524722 3:43679295-43679317 GGACCCTCCGAGCCATGCACGGG - Intronic
954500797 3:51012434-51012456 GGACCCTCCAAGCCAGGCACAGG + Intronic
954521311 3:51229113-51229135 AGACTCTCCCAGTCAAGGACAGG - Intronic
954950088 3:54464565-54464587 GGACCCTCCGAGCCAAGTGCGGG + Intronic
955211482 3:56945472-56945494 GGACCCTCCAAGCCAGGCACAGG - Intronic
956497072 3:69839559-69839581 GCATCCTCCCAGCCATCGGCTGG + Intronic
956511528 3:69998930-69998952 GCTCCCTCCCAGCCAACAAAGGG + Intergenic
956589489 3:70898596-70898618 GGACCCTCCAAGCCAGGCACGGG + Intergenic
957324493 3:78675517-78675539 GGACCCTCCGAGCCAAGTGCGGG - Intronic
958185167 3:90110777-90110799 GGACCCTCCAAGCCAGTCACAGG + Intergenic
958423034 3:93950036-93950058 GGACCCTCCGAGCCATGGGCGGG - Intronic
962180370 3:133200053-133200075 GGACCCTCCAAGCCAGGCACGGG + Intronic
962392739 3:134986447-134986469 GGACCATCCCAGCCAACATGCGG + Intronic
962442937 3:135439498-135439520 GGACCCTCCGAGCCAGGTACAGG + Intergenic
963340192 3:144023768-144023790 GGACCCTCCGAGCCAGGCACGGG + Intronic
963714416 3:148786427-148786449 GGACCCTCCGAGCCATGCACGGG + Intergenic
964715249 3:159714599-159714621 GGACCCTCCGAGCCAGGCACGGG - Intronic
967569897 3:191016232-191016254 GGACCCTCCAAGCCAGGCACGGG + Intergenic
968376041 4:42341-42363 GGACCCTCCAAGCCATGCACAGG + Intergenic
968689204 4:1981661-1981683 GGACCCAGCCAGCCATGGACGGG - Exonic
968757928 4:2426385-2426407 GGACCCTCCCCAGCAGCGACAGG - Intronic
969228515 4:5814388-5814410 GGACCCTCCTGGCCAACCAGGGG + Intronic
970358183 4:15278993-15279015 GGACCCTCCGAGCCAGGTACGGG - Intergenic
970796594 4:19920475-19920497 GGACCCTCCAAGCCATGCACGGG - Intergenic
971438678 4:26655658-26655680 GGACCCTCCGAGCCAGGCACGGG + Intronic
973626080 4:52773950-52773972 GGACCCTCCAAGCCAGGCACAGG + Intergenic
974347063 4:60696179-60696201 GGACCCTCCAAGCCAGGCACGGG - Intergenic
975286965 4:72632393-72632415 GGACCCTCCAAGCCATGCACGGG - Intergenic
975305186 4:72841311-72841333 GGACCCTCCGAGCCAAACATGGG + Intergenic
976289023 4:83398246-83398268 GGACCCTCCAAGCCATGCACGGG - Intergenic
977617173 4:99099640-99099662 GGACCCTCCGAGCCAGGCACAGG + Intergenic
978013791 4:103719696-103719718 GGACCCTCCCACTCACCCACGGG + Exonic
978231733 4:106408232-106408254 GGACCCTCCGAGCCAGGCACAGG + Intergenic
978537263 4:109775353-109775375 GGACCCTCCGAGCCAGGCACGGG - Intronic
978565472 4:110076940-110076962 GGACCCTCCGAGCCAGTCACGGG - Intronic
978658978 4:111100426-111100448 GGACCCTCCAAGCCATGCACAGG + Intergenic
979112831 4:116780699-116780721 GGACCCTCCCAGCCATGTGCGGG + Intergenic
979886102 4:126030085-126030107 GGACCCTCCGAGCCAGGCACAGG - Intergenic
980848752 4:138355094-138355116 GGACCCTCCGAGCCAGGCACAGG - Intergenic
980996405 4:139783795-139783817 GGACCCTCCCAGTCAGCGATTGG + Intronic
983687786 4:170431722-170431744 GGACCCTCCCAGCCAGGTGCGGG - Intergenic
984015226 4:174417679-174417701 GGACCCTCCCAGCCAGGCGCAGG + Intergenic
984572870 4:181414555-181414577 GGACCCTCCCAGCCAGGTGCGGG + Intergenic
984696434 4:182784720-182784742 GGACCCTCCCAGCCAGGTGCGGG + Intronic
984857655 4:184208565-184208587 GGACCCTCCCAGCCAGGTGCGGG - Intronic
984883353 4:184429287-184429309 GGACCCTCCCAGCGGAGGGCAGG - Intronic
985473793 5:65921-65943 GGACCCTCCCGGCCAGGGGCGGG + Intergenic
986877170 5:12125980-12126002 GGACCCACCCAGCCAGACACGGG - Intergenic
988003963 5:25384198-25384220 GGACCCTCCGAGCCAGGGGCGGG + Intergenic
988284346 5:29191755-29191777 GGACCCTCCCAGCCAGGTGCAGG + Intergenic
989521276 5:42403514-42403536 GGCTGCTCCCAGCCAACAACTGG - Intergenic
989804455 5:45586310-45586332 GGACCCTCTGAGCCAAGCACGGG + Intronic
990360395 5:55013193-55013215 GGACCCTCCGAGCCAGGTACGGG - Intronic
990678614 5:58216250-58216272 GGACCCTCCCAGCCAGGTGCGGG - Intergenic
990783619 5:59395057-59395079 GGACCCTCCCAGCCAGGTGCGGG - Intronic
990887879 5:60615501-60615523 GGACCCTCCGAGCCAGGCACGGG - Intronic
991545789 5:67780361-67780383 GGACCCTCCCAGCCAGGTGCGGG - Intergenic
992604431 5:78440995-78441017 GGACCCTCCGAGCCAGGCACAGG + Intronic
992631156 5:78682293-78682315 GGACCCTCCGAGCCAGATACAGG - Intronic
992926389 5:81592189-81592211 GGACCCTCCGAGCCAAGTGCGGG - Intronic
993305479 5:86270787-86270809 GGACCCTCCAAGCCAGGCACAGG + Intergenic
993688471 5:90970079-90970101 GGACCCTCCGAGCCAGGCACGGG - Intronic
994266588 5:97723564-97723586 GGACCCTCCAAGCCAGGCACGGG + Intergenic
994316910 5:98343331-98343353 GGACCCTCCGAGCCAGGCACAGG - Intergenic
994973845 5:106776784-106776806 GGACCCTCCCAGCCAGGTGCGGG + Intergenic
995179160 5:109214240-109214262 GGACCCTCCTAGCCAGGCACGGG + Intergenic
996477864 5:123941719-123941741 GGACCCTCCGAGCCAGGCACGGG - Intergenic
996753137 5:126909486-126909508 GGACCCTCCGAGCCACGCACAGG + Intronic
997107253 5:131034496-131034518 GGACCCTCCAAGCCAGGCACAGG + Intergenic
998463824 5:142327267-142327289 GGCCCCTCCCAGCTCAAGACTGG - Intergenic
998760239 5:145424402-145424424 GGACCCTCCCAGCCAGGTGCGGG + Intergenic
998803166 5:145891488-145891510 GGACCCTCCGAGCCAGGCACAGG - Intergenic
999242642 5:150136659-150136681 GGAAGCTCCCAGCCAATGAGGGG + Intronic
999606856 5:153325665-153325687 GGACCCTCCCAGCCAGGTGCAGG - Intergenic
1001212165 5:169819975-169819997 GGACCCTCCAAGCCAGGCACGGG - Intronic
1001792059 5:174466224-174466246 GGACCCGCCGAGCCAGGGACAGG - Intergenic
1001898068 5:175398108-175398130 GGACCCTCCCAGCCAGGTGCTGG - Intergenic
1002265583 5:178029586-178029608 GGACCCTCCGAGCCAGGTACAGG + Intronic
1202773475 5_GL000208v1_random:35554-35576 GGACCCTCCCAGCCAGTTGCGGG + Intergenic
1004831535 6:19482079-19482101 GGACCCTCCAAGCCAGGCACGGG - Intergenic
1004993099 6:21161031-21161053 GCACCCCCCCAGCCAACAAAAGG - Intronic
1006320933 6:33319080-33319102 GGACTCTCCCAGCCATGGCCTGG - Exonic
1006399290 6:33807117-33807139 GGAGCCTCCAAGCCCAAGACAGG + Intergenic
1007134581 6:39508561-39508583 GGACCCACCGAGCCAGCCACGGG - Intronic
1007153882 6:39723737-39723759 GTAGCCTCCCACCCCACGACAGG - Intronic
1008474609 6:51922734-51922756 GGACCCTCCGAGCCAGGCACGGG + Intronic
1008798766 6:55340878-55340900 GGACCCTCCAAGCCAGGCACGGG - Intronic
1008874138 6:56307509-56307531 GGACCCTCCAAGCCAGGCACGGG + Intronic
1009870318 6:69445207-69445229 GGACCCTCCGAGCCAAGTGCAGG + Intergenic
1010093010 6:72006679-72006701 GGACCCTCCGAGCCAGGCACGGG - Intronic
1010105650 6:72164177-72164199 GGACCCTCCGAGCCAAGTGCAGG + Intronic
1010652101 6:78467545-78467567 GGACCCTCCGAGCCAAGTGCGGG - Intergenic
1010721231 6:79285013-79285035 GGACCCTCCAAGCCAGGAACAGG - Intergenic
1010944532 6:81958816-81958838 GGACCCTCCGAGCCAGGCACGGG + Intergenic
1011306791 6:85936227-85936249 GGACCCTCCAAGCCAGGTACGGG + Intergenic
1012087696 6:94851470-94851492 GGACCCTCCCAGCCAGGTGCGGG - Intergenic
1012094569 6:94942472-94942494 GGACCCTCCCAGCCAGGTGCGGG - Intergenic
1012923538 6:105244713-105244735 GGACCCTCCCAGCCATGTGCGGG - Intergenic
1012933231 6:105338742-105338764 GGACCCTCCGAGCCAGGGGCGGG - Intronic
1013258239 6:108411115-108411137 GGACCCTCCAAGCCAGGCACAGG - Intronic
1014277213 6:119400322-119400344 GGACCCTCCGAGCCATGCACGGG - Intergenic
1014764995 6:125396255-125396277 GGACCCTCCAAGCCATCTGCGGG - Intergenic
1014842912 6:126240995-126241017 GGACCCTCCGAGCCAGGCACAGG + Intergenic
1015179510 6:130346426-130346448 GGACCCTCCAAGCCAGGCACAGG - Intronic
1015430336 6:133123443-133123465 GGACCCTCCAAGCCAGGCACGGG + Intergenic
1015677957 6:135771151-135771173 GGACCCTCCCAGCCAGGTGCGGG + Intergenic
1017497308 6:154994071-154994093 GGCCGCTCCCAGCCAAGGACTGG + Intronic
1018351627 6:162965742-162965764 GGAAACTCACAGCCAATGACAGG + Intronic
1018981987 6:168608189-168608211 GGGCCCACCCAGCCAAAGCCCGG + Exonic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1020645687 7:10811688-10811710 GGACCCTCCAAGCCAGGGGCAGG + Intergenic
1021342287 7:19479817-19479839 GGACCCTCCTAGCCATGCACGGG + Intergenic
1023948671 7:44823706-44823728 GGACACTCCCAGCCACTGAGTGG + Intronic
1024877921 7:54047108-54047130 GGACCCTCCCAGCCAGGTGCAGG + Intergenic
1025868472 7:65407592-65407614 GGACCCTCCGAGCCAGGCACGGG + Intergenic
1025869212 7:65415127-65415149 GGACCCTCCAAGCCAGGCACGGG - Intergenic
1026909740 7:74084763-74084785 GGACTCCCCCAGCCTAGGACAGG + Intronic
1030131954 7:106209062-106209084 GGACCCTCCGAGCCAGGCACGGG - Intergenic
1031344732 7:120651402-120651424 GGACTCTCCCAGCCATGCACGGG + Intronic
1031482844 7:122299903-122299925 GGACCTTCCCAGCCCACACCAGG + Intergenic
1032686492 7:134239404-134239426 GGACCCTCCGAGCCAGGCACAGG - Intronic
1033902256 7:146157589-146157611 GGACCCTCCAAGCCATGCACGGG - Intronic
1034780108 7:153871437-153871459 GGACCCTCCGAGCCAAGTGCGGG + Intergenic
1035318337 7:158012116-158012138 GGACTCTCTCAGCCAAGGAGTGG - Intronic
1035558845 8:589853-589875 GGACCCTCCAAGCCAGGCACGGG + Intergenic
1037094834 8:14973277-14973299 GCTCCCACCCAGCCAAAGACTGG - Intronic
1040591764 8:48799572-48799594 GGACCCTCCGAGCCAGGTACGGG + Intergenic
1040777036 8:51057670-51057692 GGCTGCTCCCAGCCAATGACTGG - Intergenic
1041321006 8:56612443-56612465 GGACCCTCCCTGCCAGAAACAGG - Intergenic
1043177590 8:77042196-77042218 GGACCCTCCGAGCCATGCACGGG - Intergenic
1043182704 8:77105854-77105876 GGACCCTCCGAGCCAGGCACGGG - Intergenic
1043497918 8:80823275-80823297 GGACCCTCCGAGCCAGGCACGGG - Intronic
1044548278 8:93483582-93483604 GGACCCTCCGAGCCAGGCACAGG - Intergenic
1044798967 8:95933707-95933729 GGACCCACCCAGCCAGGCACAGG + Intergenic
1044811784 8:96070757-96070779 GGACCCTCCAAGCCAGGCACAGG - Intergenic
1045083152 8:98650689-98650711 GGACCCTCCGAGCCATGGGCGGG - Intronic
1045143553 8:99313954-99313976 GGACCCTCCAAGCCAGGCACGGG + Intronic
1045177261 8:99739178-99739200 GGACCCTCCGAGCCAGGTACGGG - Intronic
1045241083 8:100402151-100402173 GGACCCTCCAAGCCAGGCACGGG - Intronic
1045535231 8:103021284-103021306 CGTCCCTCCCAGGCAGCGACCGG - Intronic
1047046277 8:121056476-121056498 GGACCCTCCCAGCCATGTGCGGG + Intergenic
1048581631 8:135733772-135733794 TGACCCGCACAGCCAACTACAGG - Intergenic
1048792490 8:138116503-138116525 GGACCCTCCCAGCCAGGTGCGGG - Intergenic
1049074375 8:140382494-140382516 GGACCCTCCCAGCCATGCGCGGG - Intronic
1049610843 8:143554016-143554038 GGCCCCTCCCAGACACCGGCAGG - Intronic
1050478277 9:6063440-6063462 GGACCCTCCGAGCCACACACGGG + Intergenic
1051296423 9:15600922-15600944 GGACCCTCCGAGCCAAGCGCGGG + Intronic
1051516119 9:17932159-17932181 GGAGCCTCTCAGCCAACCATGGG + Intergenic
1053009572 9:34625476-34625498 GGACCCTCCCACCCCAGGCCAGG + Intronic
1053521021 9:38779728-38779750 GGACCCTCCGAGCCATGCACGGG - Intergenic
1053582963 9:39425969-39425991 GGACCCTCCAAGCCAGGCACAGG - Intergenic
1053847145 9:42250830-42250852 GGACCCTCCAAGCCAGGCACAGG - Intergenic
1054104542 9:60984712-60984734 GGACCCTCCAAGCCAGGCACAGG - Intergenic
1054193178 9:62003721-62003743 GGACCCTCCGAGCCAGGCACGGG - Intergenic
1054581800 9:66922137-66922159 GGACCCTCCAAGCCAGGCACAGG + Intronic
1054645229 9:67584970-67584992 GGACCCTCCGAGCCAGGCACGGG + Intergenic
1054997348 9:71407427-71407449 GGACCCACCAAGCCATCCACAGG - Intronic
1056668067 9:88597644-88597666 GGACCCACCCAGCCAGGCACGGG - Intergenic
1057078471 9:92154158-92154180 GGACCCACCCAGGCAAGGCCAGG + Intergenic
1058563991 9:106261145-106261167 GGACCCTCCAAGCCAGGCACAGG + Intergenic
1058687650 9:107491820-107491842 CGGCCCTCCCTGCCAACGCCAGG + Intergenic
1060103280 9:120858000-120858022 TGACCCTCCGAGCCAACACCTGG + Exonic
1203573185 Un_KI270744v1:151809-151831 GGACCCTCCAAGCCATGCACAGG - Intergenic
1186611644 X:11143771-11143793 GGACCCTCCCAGCCAACGACTGG + Intronic
1186914650 X:14206665-14206687 GGACCCTCCGAGCCAGGCACGGG + Intergenic
1186982755 X:14974787-14974809 GGACCCTCCGAGCCATGCACAGG + Intergenic
1187436886 X:19279151-19279173 GGACCCTCCAAGCCAGGCACAGG + Intergenic
1188219805 X:27527311-27527333 GGACCCTCCAAGCCAGGCACAGG + Intergenic
1188238662 X:27758915-27758937 GGACCCTCCTAGCCACGCACGGG - Intergenic
1188461218 X:30429555-30429577 GGACCCTCCAAGCCAGGCACGGG - Intergenic
1188795369 X:34457966-34457988 GGACCCTCCGAGCCAGGCACGGG - Intergenic
1189042838 X:37560847-37560869 GGACCCTCCAAGCCAGGCACGGG - Intronic
1189832525 X:44989191-44989213 GGACCCTCCGAGCCAGACACGGG + Intronic
1189934986 X:46058142-46058164 GGACCCTCCGAGCCAGGCACGGG + Intergenic
1190327986 X:49218470-49218492 GGCCCCTCCGAGCCATCAACAGG - Exonic
1190554837 X:51623472-51623494 GGACCCTCCGAGCCAAGCGCAGG - Intergenic
1190720730 X:53145358-53145380 GGACCCTCCGAGCCAGGGGCGGG - Intergenic
1190800468 X:53783692-53783714 GGACCCTCCAAGCCAGGGGCAGG - Intergenic
1190962861 X:55269435-55269457 GGACCCTCCAAGCCATGCACGGG - Intronic
1190966150 X:55303430-55303452 GGACCCTCCAAGCCAGGCACGGG + Intergenic
1191016106 X:55811834-55811856 GGACCCTCCTAGCCAGGCACGGG + Intergenic
1191048266 X:56162555-56162577 GGACCCTCCAAGCCAAGCATAGG + Intergenic
1191138367 X:57090785-57090807 GGACCCTCCAAGCCAGGCACGGG + Intergenic
1191208845 X:57863513-57863535 GGACCCTCCTAGCCATGCACAGG - Intergenic
1191646972 X:63492431-63492453 GGACCCTCCGAGCCAGCCGCGGG - Intergenic
1191656305 X:63602861-63602883 GGACCCTCCCAGCCAGGTGCGGG + Intergenic
1191656816 X:63607364-63607386 GGACCCTCCGAGCCAGGCACGGG - Intergenic
1192255000 X:69448709-69448731 GGACCCTCCCAGCCAGGTGCGGG - Intergenic
1192393635 X:70755944-70755966 GGACCCGCCGAGCCAAGCACGGG - Intronic
1192802543 X:74480269-74480291 GGACCCTCCCAGCCATGCACGGG + Intronic
1192871818 X:75191749-75191771 GGACCCTCCAAGCCAGGCACGGG + Intergenic
1192910824 X:75602282-75602304 GGACCCTCCGAGCCAGGCACGGG + Intergenic
1192985669 X:76396231-76396253 GGACCCTCCCAGCCATGCACGGG + Intergenic
1192993573 X:76488331-76488353 GGACCCTCCAAGCCAGGCACAGG + Intergenic
1193000786 X:76559892-76559914 GGACCCTCCAAGCCAGGCACGGG - Intergenic
1194658100 X:96597971-96597993 GGACCCTCCGAGCCAGGCACTGG - Intergenic
1195340596 X:103902906-103902928 GGACCCTCAGAGCCAAGCACAGG + Intergenic
1195735856 X:108011752-108011774 GGACCCTCCGAGCCAGGCACAGG - Intergenic
1195787962 X:108547895-108547917 GGACCCTCCGAGCCAGGCACGGG + Intronic
1196478782 X:116121543-116121565 GGACCCTCCGAGCCATGCACGGG - Intergenic
1196658222 X:118242041-118242063 GGACCCTCCGAGCCAGGCACGGG - Intergenic
1198553528 X:137769101-137769123 GGACCCTCCGAGCCAGGCACAGG + Intergenic
1199968524 X:152841099-152841121 GGACCCTCCGAGCCAGGCACAGG + Intronic
1200689688 Y:6294525-6294547 GGACCCTCCAAGCCAGGCACAGG + Intergenic
1200879109 Y:8193807-8193829 GGACCCTCCGAGCCAGGCACAGG - Intergenic
1201045584 Y:9880195-9880217 GGACCCTCCAAGCCAGGCACAGG - Intergenic
1202055598 Y:20826660-20826682 GGACCCTCCGAGCCAGGTACAGG + Intergenic