ID: 1186611935

View in Genome Browser
Species Human (GRCh38)
Location X:11146096-11146118
Sequence CACAGTTAGGAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 526
Summary {0: 1, 1: 0, 2: 5, 3: 54, 4: 466}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186611929_1186611935 0 Left 1186611929 X:11146073-11146095 CCTGACCTTGGGGTGACTGAGGC 0: 1
1: 0
2: 3
3: 177
4: 5702
Right 1186611935 X:11146096-11146118 CACAGTTAGGAGAAGGAGGAAGG 0: 1
1: 0
2: 5
3: 54
4: 466
1186611924_1186611935 21 Left 1186611924 X:11146052-11146074 CCTGGGAGTGAATGTGGTGGTCC 0: 1
1: 0
2: 1
3: 7
4: 118
Right 1186611935 X:11146096-11146118 CACAGTTAGGAGAAGGAGGAAGG 0: 1
1: 0
2: 5
3: 54
4: 466
1186611930_1186611935 -5 Left 1186611930 X:11146078-11146100 CCTTGGGGTGACTGAGGCCACAG 0: 1
1: 0
2: 5
3: 53
4: 442
Right 1186611935 X:11146096-11146118 CACAGTTAGGAGAAGGAGGAAGG 0: 1
1: 0
2: 5
3: 54
4: 466
1186611923_1186611935 22 Left 1186611923 X:11146051-11146073 CCCTGGGAGTGAATGTGGTGGTC 0: 1
1: 0
2: 0
3: 21
4: 147
Right 1186611935 X:11146096-11146118 CACAGTTAGGAGAAGGAGGAAGG 0: 1
1: 0
2: 5
3: 54
4: 466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186611935 Original CRISPR CACAGTTAGGAGAAGGAGGA AGG Intronic
900086073 1:897981-898003 CACACTGATGAGGAGGAGGAAGG - Intergenic
900553657 1:3269218-3269240 GACAGCTGGGAGGAGGAGGACGG + Intronic
901043264 1:6378739-6378761 AACATTTAGGGGGAGGAGGAGGG + Intronic
901157104 1:7148447-7148469 CACAGGGAGAAGAAGGAGCATGG - Intronic
901863370 1:12088758-12088780 AACAGGAAGGAGGAGGAGGAGGG + Intronic
902418398 1:16257257-16257279 CACAGGTAAGAAAAGGAGGCAGG + Intronic
902762284 1:18590028-18590050 CACCAGGAGGAGAAGGAGGAGGG - Intergenic
903222738 1:21878117-21878139 CACAGCTGGGAGGAGGAAGAAGG - Intronic
903386444 1:22930185-22930207 CTCAGGTAGGAGGAGGAGGCAGG + Intergenic
903635089 1:24808060-24808082 CCCAGTTAGGAGGCTGAGGAAGG - Intronic
904300148 1:29549014-29549036 CCCAGTGAGGACCAGGAGGAAGG - Intergenic
905116431 1:35645278-35645300 AACAGGTAGGGGAAGGGGGAAGG + Intergenic
905267580 1:36765276-36765298 CACAGTGAGGAGAAGCAGAGGGG - Intergenic
905300959 1:36985926-36985948 CACAGTGAGGAGGAGGGGGAGGG - Intronic
906819698 1:48916389-48916411 CACAGGGAGGAGAGGGAGGCGGG + Intronic
906994621 1:50778662-50778684 CAAACTGAAGAGAAGGAGGAAGG + Intronic
907278553 1:53330017-53330039 CACAGAGTGGAGGAGGAGGAGGG - Intergenic
907484586 1:54768409-54768431 CTCAGATTGGAGGAGGAGGATGG + Intergenic
907526915 1:55059121-55059143 CCCAGCTAGGAGAGTGAGGAGGG + Intronic
907618317 1:55948161-55948183 CACAGTAAGGAAATGGAGGCAGG - Intergenic
907659743 1:56381049-56381071 CAAACTTAGAAGAAGGAGAAAGG + Intergenic
907706257 1:56835069-56835091 CACAGATGGTAGAAGGAGCAAGG - Intergenic
908189239 1:61684378-61684400 CACAGTGAGGAGAAGTGGGAAGG - Intronic
910424976 1:87112660-87112682 CACAGCTAGGAGGTGGAAGATGG + Intronic
910794553 1:91084861-91084883 ACCAGTTAGGAGAAGGAAGGAGG - Intergenic
910838694 1:91540902-91540924 AACAGTCAGGAGAAGGAAGGTGG + Intergenic
910852901 1:91666099-91666121 CAGTGTTGGGAGAAGGAGGCTGG + Intergenic
911150686 1:94594723-94594745 CAGAGTTTGGGAAAGGAGGAAGG - Intergenic
911600583 1:99844088-99844110 CACAGTTTGCAGCAGGAGAATGG - Intergenic
914251952 1:145928946-145928968 CACAGTTGGGCGAAAGAGCAAGG - Intergenic
914337563 1:146729559-146729581 AACAGTTGGCAGCAGGAGGATGG - Intergenic
915257039 1:154641349-154641371 CACAGTATGGAGAAAGGGGATGG + Intergenic
915493858 1:156267245-156267267 GGCAGTAAGGAGAAGGGGGAAGG + Intronic
915494522 1:156272225-156272247 CACAGCTAGAGGAAGGAGGAAGG + Intronic
915688008 1:157655391-157655413 CGCAGTTACTAGAAGGTGGAGGG + Intergenic
915795377 1:158726736-158726758 AACAGTTAAGAGAAGCAGGAAGG - Intergenic
916407003 1:164507827-164507849 GAAAGTTAGTAGAAGGAGGTAGG - Intergenic
916918706 1:169439207-169439229 ACCAGTTGGGAGAAGGAAGAAGG + Intronic
917690310 1:177461825-177461847 CACAGATGGGTGAAGCAGGATGG - Intergenic
917792984 1:178511752-178511774 CAAAATTAGCAGAAGGAGGTGGG + Intergenic
918092516 1:181309771-181309793 CTCAGTGTGGTGAAGGAGGAAGG + Intergenic
919910484 1:202107649-202107671 AACAGGTGGGAGGAGGAGGATGG + Intergenic
920358952 1:205398778-205398800 GACAGTGAGGGGAAGGAAGAGGG + Intronic
921023425 1:211257375-211257397 CACAGTTAGGAGAAGAACCTGGG - Intergenic
921062268 1:211595677-211595699 CCCAGTTGGGAGAAGAAAGATGG - Intergenic
921256855 1:213349389-213349411 CACAGTAAGGAGAAGCAGGATGG + Intergenic
922061744 1:222099223-222099245 CTTAGCTAGAAGAAGGAGGAGGG + Intergenic
922894342 1:229088771-229088793 CAAGGTAAGGAGAAAGAGGAGGG + Intergenic
922965475 1:229687460-229687482 CACAGTGAGGAGAAATAAGAAGG + Intergenic
923121817 1:230999089-230999111 CACAGTGAAGGGAAGGAAGAGGG - Intronic
923231526 1:231990819-231990841 CAAAGTTAGGAGCAGGAGAAGGG - Intronic
923533617 1:234831015-234831037 CACACTCAGGAGAACCAGGAGGG + Intergenic
923842806 1:237692366-237692388 CACAGTTGAGAGAAGCAGGAGGG - Intronic
924278696 1:242413877-242413899 ATAAGTTAGGAGAAGGAGTAGGG + Intronic
924516338 1:244769072-244769094 CACTGTTAGGAGATTGGGGAGGG + Intergenic
924551463 1:245081799-245081821 TACAGTGAGGGGAAGGAGCATGG - Intronic
1063175749 10:3549417-3549439 AACCGTGAGGAGAAGGTGGATGG + Intergenic
1063346720 10:5318704-5318726 CAATGGTAGGAGAAGGAGGTTGG - Intergenic
1063654213 10:7970989-7971011 TACAGTTATGAGAAACAGGAAGG - Intronic
1063681861 10:8196064-8196086 CCCAGTTAGGAGGCTGAGGAAGG - Intergenic
1063865018 10:10354375-10354397 CACATTTAGGCACAGGAGGAGGG + Intergenic
1063877818 10:10498293-10498315 CACAGTAAGGAGAACCAGGAAGG + Intergenic
1064181076 10:13116262-13116284 CACAGGAAGGAGAAGCAGAAGGG + Exonic
1064248203 10:13686245-13686267 TACAGGGAGGAGAAGGAGGAAGG + Intronic
1064358316 10:14639843-14639865 CAGTGTTAGCTGAAGGAGGAAGG - Intronic
1066248008 10:33603316-33603338 GAGAGGCAGGAGAAGGAGGAAGG + Intergenic
1067292334 10:44952780-44952802 CACAGTTAGGAGGACTGGGAAGG + Intergenic
1067947063 10:50696368-50696390 CACAGGTAGGAGGAGGAGCTGGG - Intergenic
1069718398 10:70535008-70535030 CACAGGAAGGACAAGGAAGAGGG + Intronic
1069846970 10:71378976-71378998 CCCAGTGAGGAGGAGGACGATGG + Intergenic
1070707188 10:78648245-78648267 CACAGTTAGGAACAGGAAGGTGG - Intergenic
1070894897 10:79975356-79975378 CACACTGATGAGGAGGAGGAAGG - Intronic
1071175635 10:82923780-82923802 CACAGGTAGAAGGAGGAGGGGGG - Intronic
1071573422 10:86710179-86710201 CACAGCTAGGGGACGGAGGGCGG - Intronic
1072564770 10:96608298-96608320 CACAGGTGGCAGAAGGAGCAAGG - Intronic
1073545018 10:104340372-104340394 GACAGTTTGGAGGAGGAGGTGGG - Intergenic
1074322906 10:112420211-112420233 CAGAGTTGGGAGAGAGAGGAAGG - Intronic
1074398558 10:113121271-113121293 GACAGCTAGGAGAGGAAGGAAGG - Intronic
1074691336 10:116007335-116007357 GACAAGTAGGAGAGGGAGGAGGG + Intergenic
1074938704 10:118213720-118213742 AAGAGTTTGGAGAAGGAGGGAGG + Intergenic
1076081780 10:127588883-127588905 CTCAGTTAGGAGCTGGAGGCAGG + Intergenic
1076574192 10:131453167-131453189 CACATTTAGGAGAGGAAGGCTGG + Intergenic
1077921861 11:6647340-6647362 CAGAGCTGGAAGAAGGAGGAGGG + Intronic
1078085737 11:8232163-8232185 TGCAGGGAGGAGAAGGAGGAGGG - Intronic
1078532614 11:12148718-12148740 CACAGTCAGGTGAGGTAGGAGGG + Intronic
1079254849 11:18819128-18819150 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1079303080 11:19296749-19296771 GACAAAGAGGAGAAGGAGGATGG + Intergenic
1079995479 11:27291044-27291066 CACACTTAGATGAAGTAGGAAGG + Intergenic
1081783067 11:45726992-45727014 CACAGCTTGGAAAAAGAGGAGGG - Intergenic
1081928436 11:46850109-46850131 CACATGTAGGAGAAGAAGAAAGG + Intergenic
1082094000 11:48112122-48112144 TACAGCTATAAGAAGGAGGAAGG + Intronic
1082096002 11:48129836-48129858 TACAGGTATAAGAAGGAGGAAGG + Intronic
1083407963 11:62471820-62471842 GGCAGTTAGGAGAAAGAGAATGG + Intronic
1083631546 11:64097923-64097945 TCCAGTGAGGAGAAGGAGGCGGG + Intronic
1085843446 11:80039865-80039887 CAAAATTTGGAGAAGGAGAAAGG + Intergenic
1086070745 11:82796322-82796344 CACAGTAACGAGAAGGAAGGAGG - Intergenic
1086192787 11:84099183-84099205 CACAGTTAGCAGACAAAGGAAGG + Intronic
1087811008 11:102609197-102609219 TCCAGTTAGGAGAAGGAGATGGG - Intronic
1088186945 11:107181094-107181116 CAGAGCTAGAGGAAGGAGGAGGG + Intergenic
1088630774 11:111772019-111772041 CAGAGGTAGGAGATGGAGGAGGG - Intergenic
1090480277 11:127061760-127061782 CAAAGAAAGGAGAAGGGGGAAGG - Intergenic
1090782539 11:130020741-130020763 CACAGGTATGAGGAGGGGGAGGG + Intergenic
1091337122 11:134780619-134780641 AAGAGTGAGGAGGAGGAGGAGGG - Intergenic
1091443989 12:533081-533103 CACTGTGGGGAGGAGGAGGATGG - Intronic
1092091257 12:5805424-5805446 TACAGTTAGGGGAAGGAAAATGG - Intronic
1092589281 12:9935772-9935794 CATCGTTAGCAAAAGGAGGATGG - Intergenic
1092860063 12:12712609-12712631 CAAAGCAAGGAGAAAGAGGAAGG - Intergenic
1093246350 12:16742071-16742093 CACAGTTATGAGAATGATGGAGG - Intergenic
1094656012 12:32419926-32419948 CACTGCTGGGAGAAGGGGGAGGG + Intronic
1095185931 12:39200497-39200519 CACACTGATGAGGAGGAGGAAGG - Intergenic
1095854170 12:46842380-46842402 CATAGTGTGGAGGAGGAGGAGGG + Intergenic
1096077952 12:48816558-48816580 CAGAGATATGAGAAGAAGGAGGG + Intronic
1096085217 12:48861151-48861173 GAAGGGTAGGAGAAGGAGGAAGG + Intronic
1096308259 12:50498111-50498133 CACACTGATGAGGAGGAGGAAGG - Intergenic
1097246521 12:57610492-57610514 GACAGGTAGGAGAAGGGGAAGGG + Intronic
1099048461 12:77753641-77753663 CACAGTCAGTAGAAAAAGGAGGG + Intergenic
1099211816 12:79800302-79800324 CACACTGAGGAGGAAGAGGAGGG - Intronic
1100930748 12:99607091-99607113 CAGAGTTAGGCCAGGGAGGATGG + Intronic
1100981394 12:100165535-100165557 CACAGTTAGCAGATGGTGGTTGG - Intergenic
1101122434 12:101597135-101597157 CACAGTTAGGAGAAGAAGAAAGG - Intronic
1101973764 12:109336964-109336986 CACACTTACTAGAAGGAGGGAGG + Intergenic
1102529152 12:113533250-113533272 CACAGCCGGGAGATGGAGGAAGG - Intergenic
1102538833 12:113603289-113603311 AATAATTAGGAGAAGGTGGAAGG - Intergenic
1102554987 12:113720884-113720906 CAGAGTTGGGGGGAGGAGGAAGG + Intergenic
1103324654 12:120112334-120112356 CCCAGGCAGGAGCAGGAGGAAGG - Intronic
1103402577 12:120653373-120653395 CACAGTATGGAGAAGGAAGCTGG + Intronic
1103851864 12:123938602-123938624 CAGCGTTAGGAGGAGTAGGATGG - Intronic
1103964930 12:124632650-124632672 CAAAGAGAGGAGAGGGAGGAAGG - Intergenic
1104472083 12:129037298-129037320 CACAGTCACGTGAAGGAGGGTGG - Intergenic
1104797858 12:131532140-131532162 CACAGGTAGAAGATGGAGGGAGG - Intergenic
1105303750 13:19155478-19155500 CACTGCTAGGTGGAGGAGGAGGG + Intergenic
1105900171 13:24746438-24746460 CACAGCAAGGACCAGGAGGACGG - Intergenic
1106712929 13:32357978-32358000 GACAGTTAAGAGAAGAAAGAGGG - Intronic
1106780781 13:33057081-33057103 CCCAGTAAAGAGGAGGAGGAAGG - Intronic
1106939902 13:34766733-34766755 CTCAGTTATAAGTAGGAGGAGGG + Intergenic
1107265279 13:38546117-38546139 CAGAGTCTGGAGAAGGAGCATGG + Intergenic
1108105871 13:47008459-47008481 CAGAGGGAGGAGGAGGAGGAGGG + Intergenic
1108554381 13:51578721-51578743 CACAATTTAAAGAAGGAGGAAGG + Intergenic
1109044725 13:57394844-57394866 CACAGTTAGATGAAGGGGAAGGG - Intergenic
1109213797 13:59564757-59564779 CACAGTTAGATAAAGCAGGAAGG + Intergenic
1110323751 13:74189517-74189539 CACAGTTAGCAGAGGGAACAAGG - Intergenic
1111051363 13:82886128-82886150 CACAGTTATGGGAAGAAAGATGG - Intergenic
1111774282 13:92640006-92640028 CAGAATTAGGAGAGGGAGAAGGG - Intronic
1112045653 13:95594903-95594925 GACAGTTTGGAGAAGAATGATGG + Intronic
1112221784 13:97498424-97498446 AATAGAAAGGAGAAGGAGGATGG - Intergenic
1112679458 13:101745851-101745873 CACACTTAGGGGAATGAAGATGG + Intronic
1113574935 13:111388660-111388682 GACAATGAGGAGAGGGAGGAGGG - Intergenic
1114503243 14:23187723-23187745 CATAGTTACGAGAAGAAGGATGG - Intronic
1115489947 14:33949753-33949775 CATAGTTAGGAAAAGGAAGGTGG + Intronic
1116069718 14:40028099-40028121 TATAGCTAGGAGTAGGAGGATGG - Intergenic
1117043030 14:51785313-51785335 AGCAAGTAGGAGAAGGAGGAGGG - Intergenic
1117558718 14:56912876-56912898 CAGAGTCAGGGGAAGGATGAGGG + Intergenic
1118261409 14:64250708-64250730 CTGAGTTCGGGGAAGGAGGAGGG - Intronic
1118467737 14:66046022-66046044 AACAGTTATGAAAAGGAGGAGGG - Intergenic
1119087942 14:71754153-71754175 GACAGTCCGCAGAAGGAGGAAGG + Intergenic
1120098419 14:80416029-80416051 AACAGTTAGAAGAAGAAGTAGGG + Intergenic
1120870833 14:89336192-89336214 CACCGTTAGGAGAATGGGGAAGG - Intronic
1120895941 14:89532482-89532504 AACAGTTTGGAGAGGGAAGAGGG - Intronic
1121375813 14:93410092-93410114 CACTGCTAGGTGAGGGAGGAAGG - Intronic
1123789041 15:23701255-23701277 CACACTGATGAGGAGGAGGAAGG - Intergenic
1124347045 15:28930041-28930063 AACAGGTAGGAAAAGGTGGAAGG + Intronic
1124470342 15:29978671-29978693 TACAGATAGGAGCAGCAGGATGG - Intergenic
1125523668 15:40362156-40362178 CACAGTTGGGAGAGGGAGTTGGG - Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1126330158 15:47523089-47523111 CACTGTTAGCAGATGGAAGATGG - Intronic
1127299647 15:57640072-57640094 GACAGTTAGGAGAGAAAGGATGG - Intronic
1127808902 15:62546134-62546156 CACAGTGTGGAGAGGGAGGTCGG + Intronic
1128525063 15:68406787-68406809 CTCAGTGAGGAAAAGGAGAAAGG + Intronic
1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG + Intergenic
1129301056 15:74625785-74625807 CACAGGCTGGAGGAGGAGGATGG - Exonic
1129445546 15:75615342-75615364 TAGAGTTGGGAGAAGGAGTATGG - Intronic
1129464445 15:75716077-75716099 CACACTTATAAGAAGGAAGAAGG + Intergenic
1129597130 15:76973928-76973950 CACAGTAAGTAGTGGGAGGATGG + Intergenic
1129648277 15:77458934-77458956 CACAGAAAGGAGAAGGGGGTGGG - Intronic
1129720801 15:77876935-77876957 CACACTTATAAGAAGGAAGAAGG - Intergenic
1130954372 15:88616488-88616510 CACAGCTAGCAGAAGTTGGAGGG + Intergenic
1131901131 15:97088768-97088790 AAAAGGAAGGAGAAGGAGGAGGG - Intergenic
1131962263 15:97802022-97802044 CACTTTGAGTAGAAGGAGGAAGG + Intergenic
1133431669 16:5742327-5742349 GAAAGTTAGGAGAGGAAGGAAGG - Intergenic
1133770357 16:8863999-8864021 CACAGCTGGGGGAGGGAGGAAGG + Intronic
1133953979 16:10423752-10423774 CACACTGATGAGGAGGAGGAAGG - Intronic
1134040099 16:11061861-11061883 CAGAGTTGGGAGACGGAGGAAGG - Intronic
1134407177 16:13970641-13970663 CACTGCTGGGGGAAGGAGGAAGG + Intergenic
1135879953 16:26245530-26245552 CATAGAGAGGAGAAGGAGGCTGG + Intergenic
1136124366 16:28166876-28166898 CACAGTGTGGTCAAGGAGGATGG - Intronic
1136511427 16:30740028-30740050 CACCCTTAGGGGAAGGGGGAGGG + Exonic
1136621259 16:31430167-31430189 CACTTTTGGGAGAATGAGGAGGG + Intergenic
1136778665 16:32884485-32884507 CAAAGTTAGGAGAAGGATGCTGG - Intergenic
1136891955 16:33977029-33977051 CAAAGTTAGGAGAAGGATGCTGG + Intergenic
1138150973 16:54656725-54656747 CACAGTGAGTAGATGGAAGAAGG + Intergenic
1138804433 16:60077717-60077739 CATAGTTGGGAGATGGAGGAAGG - Intergenic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1139635030 16:68253298-68253320 GGCAGGTAGGAGAAGGAGCAAGG - Intronic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1139972615 16:70785672-70785694 CTCAGTGAGGAGGAGGAGGAGGG + Intronic
1139996718 16:70987769-70987791 AACAGTTGGCAGCAGGAGGATGG + Intronic
1140467146 16:75191596-75191618 CAAAATTAGGAGCAGGGGGAGGG + Intergenic
1141405503 16:83789282-83789304 CAAGGATTGGAGAAGGAGGAGGG + Intronic
1141775672 16:86121468-86121490 GACAGGGAGGAGGAGGAGGAGGG - Intergenic
1203081081 16_KI270728v1_random:1146579-1146601 CAAAGTTAGGAGAAGGATGCTGG - Intergenic
1142685844 17:1576540-1576562 CGCAGTTAGCAGAAGGGGGCAGG + Intronic
1142958162 17:3535196-3535218 GACAGAAGGGAGAAGGAGGAGGG - Intronic
1143407764 17:6689286-6689308 CACAGCCAGGAAAACGAGGATGG - Intronic
1143831637 17:9656675-9656697 CACAGCTAAGAGAAGGAAGCAGG - Intronic
1145238733 17:21227088-21227110 CGGAGTCAGAAGAAGGAGGATGG + Intergenic
1145260550 17:21352106-21352128 CCAAGTCAGGAGAGGGAGGAGGG + Intergenic
1145828805 17:27898359-27898381 TGCAGGTTGGAGAAGGAGGATGG - Intergenic
1146138366 17:30343110-30343132 CAAACTTAGGGGAAGGAAGAGGG - Intergenic
1146376149 17:32295893-32295915 CACAGGTAGTATAGGGAGGAAGG + Intronic
1146478209 17:33180320-33180342 CACAATGAGGGGAAGGAGCATGG + Intronic
1147339919 17:39747121-39747143 CAGAGCTAGGAGAAGGAGAGGGG - Exonic
1147976541 17:44251213-44251235 CACAGTGAGGATGAGGACGAAGG + Exonic
1148208127 17:45792270-45792292 CAGAGTTGGCAGAAAGAGGAAGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148744529 17:49911007-49911029 CACAGTGAAGAGTAGAAGGAGGG - Intergenic
1148777041 17:50101773-50101795 CCCAGGAATGAGAAGGAGGAGGG - Intronic
1149433883 17:56617156-56617178 GACAGGGAGGTGAAGGAGGAGGG - Intergenic
1149696968 17:58623714-58623736 CACAAATAGGAGGAGGAGGAAGG + Intronic
1150891347 17:69153792-69153814 CACAATTTGTAGCAGGAGGAAGG - Intronic
1151084438 17:71364457-71364479 CACAGTAAGGAGAGGGAGGAGGG - Intergenic
1151535986 17:74738950-74738972 CATAGTGGGTAGAAGGAGGAGGG - Intronic
1151840015 17:76611011-76611033 CACAGCAAAGAGCAGGAGGATGG + Intergenic
1151860835 17:76760370-76760392 CACATTGAGAAGGAGGAGGAGGG + Intronic
1152198993 17:78934307-78934329 CACACGGAGGAGGAGGAGGAAGG - Intergenic
1152318234 17:79593243-79593265 AAGAGCTGGGAGAAGGAGGAAGG - Intergenic
1152392182 17:80009614-80009636 CACAGCTATGAGAAAGAGGGAGG + Intronic
1152497878 17:80687183-80687205 GACAGTGAGGAGAAGTGGGACGG - Intronic
1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG + Intronic
1153401874 18:4690801-4690823 CAGAATTAGGAGAAGGAAAAAGG + Intergenic
1153912213 18:9714246-9714268 CACAGATGGGAGCAGGAGGCGGG + Intronic
1154121364 18:11655082-11655104 CCCAGTTTGGAGAAGGAGGCCGG + Intergenic
1155012321 18:21792180-21792202 CACAGCAAGGTGGAGGAGGAAGG - Intronic
1155080750 18:22407660-22407682 CGCAGTTTGGAAAAGTAGGAAGG - Intergenic
1155225319 18:23724892-23724914 CACAGATATGAGAAGGAGCAAGG - Intronic
1157488609 18:48107167-48107189 AACCGTCAGGAGAGGGAGGAAGG + Intronic
1158993976 18:62898414-62898436 CACAGTGAGAAGAAAAAGGAAGG - Intronic
1159189648 18:65025200-65025222 CATAGTTAGGAGAAGGGAGAAGG - Intergenic
1159893036 18:73970851-73970873 TACAGTTAGGAGAATGAGAAAGG - Intergenic
1159900381 18:74039490-74039512 CACAGCCAGGAGCAGGAGGAAGG - Intergenic
1160470189 18:79124823-79124845 CACAGTTAGCAGTTGGAGGAAGG + Intronic
1161345954 19:3768814-3768836 CAGAGTGAGGAGGGGGAGGAGGG - Intergenic
1161623200 19:5310055-5310077 CAGAGTGAGGAGGGGGAGGAGGG - Intronic
1161944773 19:7428777-7428799 CACAGTTAGGAGAGAGATCAGGG - Intronic
1162642503 19:12022703-12022725 CACACTGATGAGGAGGAGGAAGG + Intronic
1163415063 19:17181317-17181339 CACGGGGAGGAGACGGAGGATGG - Intronic
1164389226 19:27803815-27803837 CACAGTCAGGAGAAAGGTGATGG - Intergenic
1164521289 19:28982174-28982196 GAGAGGGAGGAGAAGGAGGAAGG + Intergenic
1165671838 19:37686517-37686539 CACAGACTGGAGAAGGAGAATGG + Exonic
1165730792 19:38143370-38143392 CACTGCAAGGAGGAGGAGGAAGG - Intronic
1165998346 19:39861904-39861926 CACAGTTAGGAGGCCGAGGCAGG - Intergenic
1166423833 19:42658349-42658371 CACAGCTAGCAGGATGAGGATGG - Intronic
1167354267 19:48993555-48993577 CAAAGTGGGGAGGAGGAGGAGGG + Exonic
1168135798 19:54350506-54350528 TCCAAATAGGAGAAGGAGGAGGG + Intergenic
1168320723 19:55508006-55508028 GACAGTGAGGAGAGGGAGGCAGG + Intronic
1168402494 19:56093462-56093484 AACACTGAGGGGAAGGAGGACGG - Intronic
1168546799 19:57259249-57259271 CACAGAGAGGAGAAAGAGTAGGG - Intergenic
925076244 2:1018585-1018607 GAAAGTTTGGAAAAGGAGGAAGG + Intronic
925436726 2:3844740-3844762 CACAGTTAGGGAATAGAGGAAGG - Intronic
925541440 2:4971989-4972011 GAGAGGGAGGAGAAGGAGGAAGG - Intergenic
925545499 2:5011402-5011424 CAAAGTGAGTAGAAGAAGGAGGG - Intergenic
926573180 2:14552155-14552177 CACAGTTAGGAGGCTGAGGCAGG + Intergenic
926714193 2:15911031-15911053 TCCAGTTTGGAGAAGGAGGATGG + Intergenic
926777357 2:16435704-16435726 CAGAGTTAGGGGAGGGAGAATGG - Intergenic
927743898 2:25598200-25598222 TCCAGGTAGAAGAAGGAGGAAGG - Intronic
928299344 2:30111726-30111748 CACCGCTAGGAGTAGAAGGAGGG - Intergenic
928582302 2:32721430-32721452 CAAAGATATGAGAATGAGGATGG - Intronic
929536230 2:42786083-42786105 CACAGTGAGGGAAGGGAGGAGGG + Intronic
930615226 2:53586832-53586854 CACAGTGAGGAAGAGGAGGAAGG + Intronic
930806671 2:55497264-55497286 CACAGATAGCAGGAGGAAGAGGG + Intergenic
931166608 2:59755739-59755761 CACAATTAGGAAAAGCATGAGGG - Intergenic
932118639 2:69077745-69077767 CCCAGTTAGGAGAACGGAGAGGG - Intronic
932624526 2:73286771-73286793 AACAGAAAGGGGAAGGAGGAGGG - Intergenic
932660114 2:73644307-73644329 CACAGGGAGGAGGATGAGGAAGG + Intergenic
932666681 2:73703988-73704010 CACAGGGAGGAGGATGAGGAAGG + Intergenic
932949987 2:76281693-76281715 CACAATTAAGAGAAAGATGAGGG - Intergenic
933053988 2:77638340-77638362 CACTCTTGGGAGAAGGGGGAGGG - Intergenic
935768394 2:106392552-106392574 CACAGTCAGGAGAAATAGAAAGG - Intronic
937629591 2:124085544-124085566 CAAAGGTAGCAGAAGGAAGAGGG - Intronic
937704149 2:124898856-124898878 TACTGTTAGGAGGAGGAGGCCGG - Intronic
939095596 2:137830203-137830225 CGCAGAAAGGAGAAGCAGGAAGG - Intergenic
939875357 2:147571448-147571470 GACAGTGAGGACAAGGAGGTTGG + Intergenic
940253720 2:151707508-151707530 TACAAGTAGGAGGAGGAGGATGG + Intronic
940293235 2:152098312-152098334 GACAGGTATGAGAAGGAGGCGGG - Exonic
940344658 2:152616779-152616801 GAAAGTAAGGAGAAAGAGGAGGG - Intronic
941086381 2:161122957-161122979 AACAGGTAGGAGAAGGAAGCTGG - Intergenic
941498832 2:166242812-166242834 CAAAGTTAGAAGATGAAGGAAGG - Intronic
942582042 2:177429779-177429801 CACAGTCAGGAGGAACAGGATGG + Intronic
944978108 2:205080978-205081000 CACAGTGATGAGAGAGAGGAGGG - Intronic
944987807 2:205198228-205198250 CACAGTTTGGAGAAGGCTAAGGG + Intronic
945190523 2:207182864-207182886 CACACTTAGGGGAATGAGGAGGG + Intergenic
946175561 2:217920067-217920089 GACAATTAGGTGGAGGAGGAGGG - Intronic
946469203 2:219940662-219940684 CTCACCTAGGAGAAAGAGGAAGG - Intergenic
946945754 2:224820359-224820381 CAAAGTGTGGAGCAGGAGGAAGG + Intronic
947205484 2:227657296-227657318 CAGCGTTTGGAGAAGGAAGAAGG + Intergenic
947636945 2:231684981-231685003 CACAGCGAGGAGGAGGAGGATGG + Intergenic
947843677 2:233226662-233226684 CAGAGTTAAGAGAAGTAGCAGGG + Intronic
947925777 2:233921316-233921338 GACAGGTAGGATGAGGAGGATGG - Intronic
948278299 2:236727081-236727103 CACATGCAGGAGAAAGAGGATGG + Intergenic
948383098 2:237564465-237564487 CACAGGTGGAGGAAGGAGGAGGG + Intergenic
948606778 2:239140929-239140951 CACAGTGAGGAGGATGAGGAGGG + Intronic
948724030 2:239920825-239920847 CACAGTTCCTAGAAGGCGGAGGG + Intronic
1168938301 20:1686827-1686849 CTCAGTTCGGGGCAGGAGGAGGG + Intergenic
1169000491 20:2164517-2164539 CACATTTGGGGGAAGCAGGAAGG - Intronic
1169427172 20:5505321-5505343 CACAGGCTGAAGAAGGAGGATGG - Intergenic
1169431432 20:5539742-5539764 CAAGGTTAGGAGAATGAGAAGGG + Intergenic
1170006457 20:11675132-11675154 CACTCTGAGGAGGAGGAGGAAGG - Intergenic
1170231694 20:14054446-14054468 CACAGTTATGAGAAGTTGGCTGG + Intronic
1170330993 20:15210475-15210497 GACAGTTAGTAGATGGTGGATGG - Intronic
1171209429 20:23305337-23305359 CACAGTTTGTGGAAGGAGGCAGG - Intergenic
1172621690 20:36321688-36321710 CAGAGTTGGGAGAACGAGCATGG + Intronic
1172982387 20:38953720-38953742 CTAAGTCAGGAGAGGGAGGAAGG - Intergenic
1173154216 20:40594230-40594252 CACAGTCAGGAGGAAGAGGAAGG + Intergenic
1174758180 20:53180622-53180644 CAGTGTTAGGAGAAGGATGTTGG - Intronic
1175757105 20:61536809-61536831 CACAGTGACGAGAGGAAGGAAGG + Intronic
1176999809 21:15598294-15598316 CACATGTAGGAGAATGATGATGG + Intergenic
1179823071 21:43948209-43948231 CACCGTTGGTAGAAGGTGGAAGG - Intronic
1180792818 22:18586002-18586024 CACAGGTGGGAGAAGGGAGAAGG - Intergenic
1181103222 22:20555352-20555374 CAGGGCTAGGAGGAGGAGGAGGG - Intronic
1181228918 22:21409317-21409339 CACAGGTGGGAGAAGGGAGAAGG + Intergenic
1181249733 22:21525548-21525570 CACAGGTGGGAGAAGGGAGAAGG - Intergenic
1181631102 22:24151834-24151856 GACAGACAGGAGAATGAGGAGGG - Intronic
1182057300 22:27369661-27369683 CAGAGTGAGGGGGAGGAGGAGGG + Intergenic
1182130723 22:27848527-27848549 TACATTTTGGGGAAGGAGGAAGG + Intergenic
1182776897 22:32837948-32837970 GACAGTTAAGAGAAAGAGAAAGG - Intronic
1184314362 22:43672703-43672725 CACCCTCAGGAGAATGAGGATGG + Intronic
1184583189 22:45430659-45430681 TGCCTTTAGGAGAAGGAGGACGG + Intronic
949498823 3:4658551-4658573 CAAGGTTTGGGGAAGGAGGAAGG - Intronic
949547544 3:5084677-5084699 AAGAGTTAGGAAAAAGAGGAGGG - Intergenic
949932478 3:9089699-9089721 TTCTGTTAGTAGAAGGAGGAAGG - Intronic
950641501 3:14351435-14351457 CACAGTTTGGTGGAGGAGGAAGG - Intergenic
950820484 3:15753136-15753158 CACAGTTAGGCTATGGAAGAAGG + Intronic
951251783 3:20402378-20402400 AACAGTTAGGAGTAGAAAGAAGG - Intergenic
951269700 3:20608784-20608806 CATCCATAGGAGAAGGAGGAAGG + Intergenic
951394811 3:22152571-22152593 CGCACTTAGGAGATGGAGGAAGG - Intronic
951554432 3:23906537-23906559 TAGACTGAGGAGAAGGAGGAGGG - Intronic
951846502 3:27090182-27090204 CAAAGTTAGGGGTAGGAAGATGG + Intergenic
952115465 3:30174816-30174838 CACAGTTATGAGACGGAGCTAGG + Intergenic
952445994 3:33381286-33381308 CACAGATTGGAGAAAGATGATGG - Intronic
952577648 3:34794406-34794428 CTCAGTTGGCAGAAGGAGGTGGG - Intergenic
952974807 3:38684711-38684733 CACTGTTACCAAAAGGAGGAAGG - Intergenic
954553563 3:51501653-51501675 CACATTTAAGAGAAGGAGGATGG - Intergenic
954559817 3:51547262-51547284 CCCAGTTAGGAGATCGAGGCGGG + Intronic
955425941 3:58790161-58790183 AATAATTAGAAGAAGGAGGAAGG - Intronic
956122059 3:65976381-65976403 CACTGTGGGGAGACGGAGGAGGG + Intronic
956920784 3:73926985-73927007 CACAGTTAGGGCAGGGAAGAAGG + Intergenic
957231542 3:77523770-77523792 CACAGTTAGCAGTGGGAGAAAGG - Intronic
957358777 3:79126952-79126974 GACACTTACGGGAAGGAGGAGGG - Intronic
957377309 3:79375269-79375291 CAGAGTTGGGAAGAGGAGGAAGG + Intronic
957640771 3:82850346-82850368 GACAATGAGGAGAAGGAGGAGGG - Intergenic
957768280 3:84655453-84655475 CACAGAAAGGTGAAGGTGGAAGG + Intergenic
959522037 3:107332170-107332192 CACAGTTAGATGAATGTGGAGGG + Intergenic
959941155 3:112082993-112083015 CTCGGTTAGGGGATGGAGGAGGG + Intergenic
960129190 3:114035749-114035771 TAAAGTTAGGTGAAGCAGGAAGG - Intronic
960598666 3:119432870-119432892 CAAAGACAGGATAAGGAGGAAGG + Intronic
960788357 3:121399150-121399172 CACACTGATGAGGAGGAGGAAGG - Intronic
961372389 3:126439656-126439678 CACAGTGAGGAAGGGGAGGAAGG + Exonic
961563697 3:127748364-127748386 CAGAGGTGGGAGAGGGAGGAGGG + Intronic
961668621 3:128509986-128510008 CCCAGTAAGGGAAAGGAGGATGG + Intergenic
961702541 3:128757631-128757653 CCCAGTTAGGAGAATGAGGCAGG - Intronic
963212268 3:142706462-142706484 GAAAGTTAGGAGAAATAGGACGG + Intronic
963504799 3:146170734-146170756 TCCAGGTAGGAGAAGGATGAAGG - Intergenic
966200518 3:177356423-177356445 CTGAGCTAGGAGAAGGTGGAGGG + Intergenic
966616285 3:181916714-181916736 CAGAGTTAGGAGCAGGATGGAGG - Intergenic
967336695 3:188352088-188352110 TTAAGTCAGGAGAAGGAGGAAGG - Intronic
968076170 3:195817042-195817064 CCCGGTAAGGAGAAGGAGGCCGG - Intergenic
969540420 4:7785096-7785118 CACAGTTAGCAGATGAATGAAGG - Intronic
970695838 4:18676054-18676076 CACAGTCAGTTAAAGGAGGAGGG + Intergenic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971377553 4:26067412-26067434 CACAGTTGGGAGAAGAAGGCCGG + Intergenic
971969495 4:33603715-33603737 CACAGGTAGCTGGAGGAGGATGG + Intergenic
972048425 4:34697561-34697583 TACAGTTTGGAGAAGGAAGATGG + Intergenic
972156784 4:36172892-36172914 CACAGAAAGGAGCAGCAGGATGG - Intronic
972908870 4:43788284-43788306 CCCAGTTGTAAGAAGGAGGAGGG + Intergenic
972965861 4:44508763-44508785 CACAGTGAGGAGAAGGAAAAAGG + Intergenic
975177188 4:71301412-71301434 CGGAGTTAGGAGAGGGAAGAAGG + Intronic
975568548 4:75788019-75788041 CACAGATTGGAGTAGGAGAATGG - Intronic
975986266 4:80203299-80203321 CACAGCGAGGTGAAGGAGGGCGG - Exonic
976398549 4:84583059-84583081 CCCAGGTAGGAGGAGGAGAAGGG - Exonic
976977880 4:91186297-91186319 CACACTGATGAGGAGGAGGAAGG - Intronic
977482986 4:97602355-97602377 TACAGATTGGAGCAGGAGGATGG - Intronic
978875699 4:113637992-113638014 CATATTTGGGAGAAGGAGGATGG - Intronic
980505618 4:133716479-133716501 CACAGATAGGTGAGAGAGGAGGG + Intergenic
980559838 4:134459071-134459093 CACAGAAAGGAGAAGAATGAAGG - Intergenic
981160191 4:141488254-141488276 CACAATTAGAACAAGGAGGCCGG - Intergenic
981816426 4:148835877-148835899 CCCAGAAAGGAAAAGGAGGATGG - Intergenic
981944490 4:150325343-150325365 CACAGTGAGGAGAAAAATGATGG - Intronic
983231027 4:165129012-165129034 AACAGTGAGGAGAAGGCTGAGGG + Intronic
983506493 4:168558545-168558567 CAGAGTTCGGAGAGGGAAGAAGG - Intronic
983569685 4:169191835-169191857 CACAGGTAGGAGAATGAAAATGG + Intronic
986043857 5:4019028-4019050 AATTGTCAGGAGAAGGAGGAAGG + Intergenic
986467151 5:8037285-8037307 CACACTGATGAGGAGGAGGAGGG - Intergenic
988247500 5:28706466-28706488 TAAAGTTTGGAGAAGGATGATGG - Intergenic
988893546 5:35647249-35647271 CTTAGTAAGGAGAAGGGGGAGGG + Intronic
991464019 5:66891331-66891353 GGCAGTGAGGAGGAGGAGGAGGG - Intronic
991998541 5:72412850-72412872 GACAGTTAAGAGAATGAGCAAGG + Intergenic
992323295 5:75635544-75635566 CAAAGTTAGAACAAGGAGCATGG + Intronic
992673879 5:79085912-79085934 CAAAGTAAGAAGAAAGAGGATGG + Intronic
992761260 5:79952626-79952648 CACACATGGGAGGAGGAGGATGG - Intergenic
993095028 5:83471666-83471688 CTCAGCGAGAAGAAGGAGGAGGG - Exonic
993952414 5:94193151-94193173 CACAGTCAGGAACAGGATGAAGG - Intronic
996845540 5:127895150-127895172 CACTGTTAGAAGAAGGTGGTGGG - Intergenic
997632541 5:135379721-135379743 CACTGAAAGGAGAAGGAAGAAGG - Intronic
998073691 5:139218908-139218930 CACAGTTGGGAGACTGAGGCGGG - Intronic
999673379 5:153976454-153976476 AAGAGTGAGGAGAGGGAGGATGG - Intergenic
1002682771 5:180981362-180981384 CACTGCTGGGAGAGGGAGGATGG + Intergenic
1003356656 6:5379536-5379558 CACAGCTGCGGGAAGGAGGAAGG - Intronic
1003584683 6:7376686-7376708 CAGAGTTGGAGGAAGGAGGAGGG - Intronic
1004291988 6:14375703-14375725 CACAGCTAGGAGAAGTATAAAGG + Intergenic
1004571915 6:16854394-16854416 TTGAGTTAGGAGAATGAGGAAGG + Intergenic
1004958436 6:20756948-20756970 CACAGTAAGGAAAGGAAGGAAGG - Intronic
1005989694 6:30895383-30895405 CGCTGTCGGGAGAAGGAGGAGGG - Exonic
1006338368 6:33432450-33432472 CACAGCTTGGAGAAGGTGGGAGG - Intronic
1006360535 6:33584693-33584715 CACAGTCAGGTGAGGGAGGCAGG - Intergenic
1006419032 6:33921976-33921998 CCCAGTCAAGAGAAAGAGGAAGG + Intergenic
1007592756 6:43032829-43032851 CCCAGTTAGGAGACTGAGGTGGG + Intronic
1008090078 6:47284807-47284829 AAAAGGTGGGAGAAGGAGGATGG - Intronic
1008310763 6:49970207-49970229 TACAGTTGAGAGAATGAGGAGGG - Intergenic
1008627530 6:53332551-53332573 CACAGAACGGAGCAGGAGGAGGG + Intronic
1010445488 6:75944255-75944277 AACAGTGAGGGGAAGGAGGAAGG - Intronic
1012275670 6:97272549-97272571 CACAATTAATAAAAGGAGGATGG + Intronic
1012762768 6:103322784-103322806 TAAAGATTGGAGAAGGAGGAGGG - Intergenic
1013609084 6:111777568-111777590 CACAGTTAGGGGAGGGAGGAGGG - Intronic
1014711617 6:124812896-124812918 TAGAATTAGGAGAATGAGGAAGG - Intronic
1014804868 6:125818095-125818117 GAAAGTAAGGAGGAGGAGGAAGG - Intronic
1015458979 6:133466675-133466697 AAGAGTTAGGTGAAGAAGGAGGG + Intronic
1015496461 6:133888905-133888927 CACAGTTGGGAGAAGGTGGCTGG + Intergenic
1016273063 6:142313056-142313078 CACAGTTTGGAGAAACAGGAGGG + Intronic
1016489964 6:144588739-144588761 CACAGTTAAGAGTAAGAGGAAGG - Intronic
1016617261 6:146065725-146065747 TCCAGATAGGAGAAGGCGGAAGG + Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017538196 6:155371259-155371281 CACAGGAAGGGTAAGGAGGAAGG - Intergenic
1018268968 6:162055582-162055604 CACAGAAAGGAGGAGGAGGGAGG + Intronic
1018547663 6:164956024-164956046 CACAGTCACAAGAAGGAGGAAGG - Intergenic
1019411456 7:908537-908559 CACAGTGAGAAGCAGGAGAAGGG - Intronic
1019536699 7:1533206-1533228 CACAGTGCGGAGAAGCAGGAAGG - Intronic
1020364989 7:7371559-7371581 CCCAGGTGGGTGAAGGAGGAAGG + Intronic
1022186262 7:27972413-27972435 CTCTTTTAGGGGAAGGAGGATGG + Intronic
1025072320 7:55910952-55910974 CACAGTCAGGAGAAGCAGACGGG - Intronic
1027537710 7:79426327-79426349 AACAAGTAGGAGAAGGAGAAAGG - Intronic
1028008286 7:85606897-85606919 CACAGTTAGGTGGAGAAAGAGGG + Intergenic
1029243720 7:99183138-99183160 CCCAGTTAGGAGGCTGAGGAAGG + Intronic
1029483875 7:100827698-100827720 GAAAGTTTGGAGAAGGGGGAGGG + Intronic
1030143281 7:106327261-106327283 GACAGTTCCTAGAAGGAGGAGGG - Intergenic
1030847089 7:114432392-114432414 CACAGATAGGAAAAGGAGATTGG + Intronic
1032204118 7:129846834-129846856 GACAGGTAGTAGAAGGAGAAAGG - Intronic
1032810747 7:135413953-135413975 TACTGTTAGTGGAAGGAGGATGG - Intronic
1033068526 7:138179994-138180016 GACAAGTAGGAGAAGGAGGCTGG - Intergenic
1033153557 7:138937185-138937207 GATAGTTACGGGAAGGAGGAGGG - Intronic
1033164487 7:139028051-139028073 CATAGTTAGGAAAAAGAGGAAGG - Intronic
1033362518 7:140647850-140647872 CAGAGTCAGGAGAAGGAGTGAGG + Intronic
1033555619 7:142486457-142486479 AAACATTAGGAGAAGGAGGAGGG - Intergenic
1033560465 7:142525985-142526007 AACCATTAGGAGAAGGAGGAGGG - Intergenic
1033575844 7:142683953-142683975 CACACTTTGAAGATGGAGGAAGG + Intergenic
1034412545 7:150948807-150948829 CACAGCTGGAAGCAGGAGGATGG + Intronic
1035161138 7:156950509-156950531 GAAAGTGAGGAGGAGGAGGAGGG + Exonic
1035485667 7:159223220-159223242 CACAGTTAGGGCAGGGAGGATGG + Intergenic
1035847666 8:2882662-2882684 CCCACTCAGCAGAAGGAGGATGG - Intergenic
1036975389 8:13405291-13405313 CACAGAGGGGAGAAGGAGGGAGG - Intronic
1037648059 8:20811680-20811702 AACATTTAAGAGCAGGAGGAAGG + Intergenic
1039035436 8:33354303-33354325 CACAATCTGGAGAACGAGGAGGG + Intergenic
1040521519 8:48180196-48180218 GAGAGTGAGGAGAAGGAGAAGGG + Intergenic
1041584044 8:59495387-59495409 GACAGTTAGCAGAAGCAGGGTGG - Intergenic
1043810816 8:84737795-84737817 CTCATTTGGCAGAAGGAGGAAGG - Intronic
1043830079 8:84978077-84978099 CAGAGTTAGAAGAATGTGGAAGG + Intergenic
1045130806 8:99149927-99149949 CACAGACAGGAGAAGGGGTATGG - Intronic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045236874 8:100359749-100359771 CACAGTTAGGAGGTGGAAGAAGG + Intronic
1045908620 8:107378726-107378748 CACAGTTAGGAGAAGTGCCAAGG - Intronic
1046797360 8:118387464-118387486 TACAATTATGAGGAGGAGGAGGG - Intronic
1046872032 8:119214431-119214453 AATAGCTATGAGAAGGAGGAAGG + Intronic
1047097438 8:121640111-121640133 CGCAGATAGGAGCGGGAGGAGGG - Intronic
1048286773 8:133147632-133147654 AGCAGTTAGGAGAATGAGCAGGG + Intergenic
1048293435 8:133197559-133197581 CATAGAGAGGAGGAGGAGGAGGG - Intronic
1048529613 8:135235470-135235492 CACAGTTGGTACAGGGAGGAGGG - Intergenic
1049356767 8:142192946-142192968 AACAGGGAGGAGCAGGAGGAAGG + Intergenic
1049438851 8:142600024-142600046 CACAGTCAGGTGAAGGGGAAGGG + Intergenic
1050063931 9:1738850-1738872 CCTAATTTGGAGAAGGAGGAGGG - Intergenic
1050188183 9:2997203-2997225 CAGAGTTAGGAGAATAAAGAAGG - Intergenic
1050265496 9:3885202-3885224 CACTGCTAGGAAAAGAAGGAAGG + Intronic
1051039229 9:12785728-12785750 CACTGCTAGGAGATGGAGGAGGG + Intronic
1051253729 9:15190184-15190206 GACATTTAGCAGAAGGAGTAGGG - Intronic
1051350302 9:16192474-16192496 AAGAGATAGGAGAAGGAGGGAGG - Intergenic
1052528884 9:29656495-29656517 TACAATTAGGAGAAGGAAAAAGG - Intergenic
1053218476 9:36292429-36292451 CAATGTTAGGAGAAGGATGAAGG - Intronic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056358713 9:85830408-85830430 CACAGTTAGGAGGCTGAGGCGGG - Intergenic
1057310945 9:93942922-93942944 AACAGGGAGGAGGAGGAGGAAGG - Intergenic
1057363015 9:94392339-94392361 CACAGTTAAGAGAAGGTACAAGG - Intronic
1057660326 9:96995760-96995782 CACAGTTAAGAGAAGGTACAAGG + Intronic
1057752393 9:97803422-97803444 GACAGGGAGGAGGAGGAGGAAGG + Intergenic
1058078559 9:100676171-100676193 CAGAGTTGGAAGAAGGAGGTGGG + Intergenic
1058104095 9:100950371-100950393 CCCAGGTAGAAGAAGGTGGATGG + Intergenic
1058552404 9:106128948-106128970 CAGAGCTACGAGATGGAGGAGGG + Intergenic
1058910074 9:109512899-109512921 GACACTTAGGGGCAGGAGGAGGG - Intergenic
1059098024 9:111439894-111439916 CACAGCAAGGAGAAGGAAGGAGG + Intronic
1059973334 9:119690127-119690149 CTCAGGGAGGAGAAGGAGAATGG - Intergenic
1060190287 9:121588416-121588438 CCCAGTTGGGATGAGGAGGACGG - Intronic
1060912142 9:127359513-127359535 CACAGTTTTGAGAAGGAAGAAGG - Intronic
1061840876 9:133357944-133357966 CACAGTGAAGAGAGGGATGATGG + Intronic
1062717216 9:138017259-138017281 CAGAGTTAGGAGTGGAAGGAAGG - Intronic
1185616800 X:1426869-1426891 CACAGTTAGGAGGCTGAGGCAGG + Intronic
1186473563 X:9839510-9839532 CACAGGCAGGAGAAAGAAGATGG - Intronic
1186611935 X:11146096-11146118 CACAGTTAGGAGAAGGAGGAAGG + Intronic
1187110294 X:16291810-16291832 CAACCTTGGGAGAAGGAGGAAGG - Intergenic
1187591441 X:20721558-20721580 CTCAGGTAGGAGGAGGAGGGAGG - Intergenic
1187926380 X:24254165-24254187 AAGAGATAGGAGAGGGAGGAAGG - Intergenic
1189095789 X:38137836-38137858 CACAGCTTGGAGAAGGAGCTAGG - Intronic
1189546601 X:42048678-42048700 CATGGTTAGGAGATGCAGGAAGG - Intergenic
1190248600 X:48706462-48706484 AACAGTTGGGAGAGTGAGGAGGG - Intronic
1190463152 X:50698907-50698929 CAGAGTTAGGAGGAGGAAGGTGG - Intronic
1192538157 X:71946184-71946206 CACAGACAGGAGCAGGAGGCAGG + Intergenic
1192939639 X:75899509-75899531 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1194877670 X:99209060-99209082 CACTGTTGGGGGATGGAGGAGGG + Intergenic
1195110142 X:101639946-101639968 GAAATTTAGGAGAGGGAGGAGGG + Intergenic
1196484084 X:116183893-116183915 CACAGAAAGGAGAAGGAGAAAGG + Intergenic
1196496509 X:116329774-116329796 CACAGCAATGAGAAGGAGCATGG + Intergenic
1197321239 X:125033558-125033580 TACAGTAAGTAGCAGGAGGAAGG + Intergenic
1197355141 X:125430325-125430347 CAGAGACAGGAGAAGGAGAAGGG - Intergenic
1197710318 X:129661656-129661678 CACAATGAGGAGAGGGAAGATGG - Intergenic
1197868373 X:131042439-131042461 CAGAGTCTGGAGAAAGAGGATGG + Intergenic
1198311631 X:135430415-135430437 CACACTTATGAAAAGAAGGATGG + Intergenic
1199190538 X:144964812-144964834 CACAATTAGCAGAAGAATGAGGG - Intergenic
1199344779 X:146725841-146725863 CACAGTCATGAGAAGGTGAAAGG - Intergenic
1199941052 X:152628219-152628241 GACAGGAAGGAGGAGGAGGAAGG + Intergenic
1201672862 Y:16543828-16543850 CAGAGTGAGGGGTAGGAGGAAGG - Intergenic
1202050330 Y:20774367-20774389 CCCAGTTGGGAGAAAGAAGATGG - Intronic