ID: 1186611971

View in Genome Browser
Species Human (GRCh38)
Location X:11146313-11146335
Sequence CACTGTTTCCTCCCTGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 207}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186611971_1186611980 10 Left 1186611971 X:11146313-11146335 CCTCCATCAGGGAGGAAACAGTG 0: 1
1: 0
2: 0
3: 17
4: 207
Right 1186611980 X:11146346-11146368 AAGCGAATCCCTGGAGGTAGAGG 0: 1
1: 0
2: 1
3: 12
4: 126
1186611971_1186611979 4 Left 1186611971 X:11146313-11146335 CCTCCATCAGGGAGGAAACAGTG 0: 1
1: 0
2: 0
3: 17
4: 207
Right 1186611979 X:11146340-11146362 TGGCTGAAGCGAATCCCTGGAGG 0: 1
1: 0
2: 1
3: 21
4: 93
1186611971_1186611983 19 Left 1186611971 X:11146313-11146335 CCTCCATCAGGGAGGAAACAGTG 0: 1
1: 0
2: 0
3: 17
4: 207
Right 1186611983 X:11146355-11146377 CCTGGAGGTAGAGGTAGATGAGG 0: 1
1: 1
2: 2
3: 44
4: 561
1186611971_1186611978 1 Left 1186611971 X:11146313-11146335 CCTCCATCAGGGAGGAAACAGTG 0: 1
1: 0
2: 0
3: 17
4: 207
Right 1186611978 X:11146337-11146359 GGGTGGCTGAAGCGAATCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186611971 Original CRISPR CACTGTTTCCTCCCTGATGG AGG (reversed) Intronic
900585060 1:3428676-3428698 AACTGGATCCTTCCTGATGGCGG - Intronic
903361772 1:22781474-22781496 CACTGACTCACCCCTGATGGAGG - Exonic
903789937 1:25885938-25885960 CACTGTTTTAGCCCTGATGAAGG - Intronic
904238638 1:29129895-29129917 CTCTGTTTCCTCCTCTATGGAGG + Intergenic
904309504 1:29619186-29619208 CACTGTGGCCTACCTGAGGGTGG + Intergenic
905262435 1:36729300-36729322 GACTGTTTCCGTCCTGATCGGGG + Intergenic
909238951 1:73187851-73187873 CACTGTCTCCTCACTGAAGCAGG + Intergenic
909522981 1:76590760-76590782 CACTGTTTCATCCCTAACTGTGG + Intronic
911172891 1:94788560-94788582 AAATATTTTCTCCCTGATGGTGG - Intergenic
912611220 1:111046684-111046706 CACTGTGGCCTACCTGAGGGTGG - Intergenic
915340088 1:155172719-155172741 CACTGTATCCTCCCTGCAGTTGG - Exonic
917653746 1:177105114-177105136 CATCATTTCCTCACTGATGGGGG + Intronic
921182690 1:212644230-212644252 CACTGCTCCCTCCCTGATCATGG + Intergenic
922360664 1:224818674-224818696 CAGTGTGTCCTCCCTGAGGGTGG - Intergenic
922663518 1:227449968-227449990 CACTGATTCCTCCCTTGGGGTGG + Intergenic
923691566 1:236198491-236198513 CACTGTATCCAGCCTGATGATGG + Intronic
1063369995 10:5514946-5514968 CACTGCTTCCCCGCAGATGGAGG - Intergenic
1063822242 10:9849827-9849849 CCTTGTATCCTCCCTGCTGGAGG + Intergenic
1065106799 10:22396749-22396771 GACTGTATCCTCCCTGATTAGGG - Intronic
1067081867 10:43216743-43216765 CCTTCTTTCCTCCCTGAGGGTGG - Intronic
1067682884 10:48451366-48451388 CAGTGCTTCCTCCCTGCTTGCGG - Intronic
1069809530 10:71148138-71148160 CACTCTCCCCTCCCTGAAGGAGG - Intergenic
1070704833 10:78630141-78630163 CACCGTTTCCTCCTTGGTGAAGG - Intergenic
1071406351 10:85337024-85337046 CACTGTATCCTCACAGAGGGAGG + Intergenic
1074276252 10:112005392-112005414 CATTTGTTCCTCCCTGGTGGGGG + Intergenic
1075120682 10:119662399-119662421 GTTTGTTTCCTGCCTGATGGAGG + Intronic
1076024773 10:127102270-127102292 CACTGTCTCCTCCGTGAAAGGGG + Intronic
1076034073 10:127184416-127184438 CACTGTTCCCACCCTGATCTTGG + Intronic
1077491646 11:2863449-2863471 CTCTGTTTCATCGCTGGTGGTGG - Intergenic
1077885542 11:6384883-6384905 CACTCTGTCCTTCCTTATGGAGG - Intergenic
1081586137 11:44385160-44385182 CTCAGTTTCCTCACTGATGGAGG - Intergenic
1082873563 11:57965979-57966001 CACTGGGGCCTCCTTGATGGTGG - Intergenic
1084714404 11:70864465-70864487 CTCTGTTTCCTCTCTGACAGTGG - Intronic
1084725209 11:70937365-70937387 CACTGCTGCCTGCCTGATGGAGG + Intronic
1085472477 11:76767159-76767181 CACTGGTTCCTCCATGATCCTGG + Intergenic
1086212521 11:84337843-84337865 CACTGTTTCTTCCTTAATAGTGG - Intronic
1086545949 11:87967639-87967661 CAGTGTTTCCTTCCAGGTGGAGG + Intergenic
1087494096 11:98867174-98867196 CATTGTTTACTCCCTGAAAGTGG - Intergenic
1088727251 11:112650263-112650285 CACTGTCATCTCCCTGGTGGAGG + Intergenic
1089098986 11:115944669-115944691 CCCTGTCACCTCCCTGATGCAGG + Intergenic
1089752310 11:120660505-120660527 CACTGTGCCCTCCCTGAGTGTGG + Intronic
1090391654 11:126392842-126392864 CACAGTTTCCTCCCTGCATGGGG - Intronic
1090797162 11:130145153-130145175 CCCTGTCACCTCACTGATGGGGG + Intergenic
1091328544 11:134712464-134712486 CTCTGTTTCCGCCCTGAGAGCGG + Intergenic
1095854244 12:46842827-46842849 CACGGCATCCTCCCTGCTGGAGG + Intergenic
1096094101 12:48923384-48923406 TACTGTCTCTTCCCTGATGGAGG + Intronic
1096878059 12:54645746-54645768 CACTCTTTCCACCCTGGTCGGGG + Intronic
1097037027 12:56130775-56130797 CTCTCTTTCCTCCCAGATTGTGG + Exonic
1097098762 12:56571268-56571290 GCCTGTTCACTCCCTGATGGAGG - Intronic
1100776042 12:97975839-97975861 CAATGTATCCTCCATGATGCTGG + Intergenic
1101200222 12:102427713-102427735 AACAGTTTACTCCCTGATGCAGG - Intronic
1103956588 12:124580618-124580640 CTCTGTTTCCTCACTGTTGATGG - Intergenic
1104345595 12:127993838-127993860 CAGTCTTTCCTCCCTGCTGCAGG + Intergenic
1104806511 12:131592612-131592634 CACTGTTTCCACCCGGCTGCAGG - Intergenic
1107393137 13:39988135-39988157 TTGTGTTTCCTCCCTGATGAGGG + Intergenic
1109886845 13:68554952-68554974 CACTGTGTCTTCCAGGATGGGGG - Intergenic
1110716400 13:78709953-78709975 CACTGTTTTCTCACAGATGTAGG - Intergenic
1112109436 13:96278979-96279001 CACTGTGTCAGCCCTCATGGAGG + Intronic
1112351377 13:98637475-98637497 CACTGGGTCCTCCTTGAGGGTGG - Intergenic
1114279337 14:21176802-21176824 CACTGTGGCCTACCTGAGGGTGG + Intergenic
1115598974 14:34937584-34937606 CCCTGATTCCTCCCCGACGGTGG + Intergenic
1116535574 14:46024505-46024527 CACTGGGGCCTACCTGATGGTGG + Intergenic
1117274611 14:54180143-54180165 CACGGTTTCCTTCCTTATGAAGG + Intergenic
1117512120 14:56463038-56463060 CAGTGTTTCCTGCATGATGCCGG + Intergenic
1119687956 14:76647866-76647888 CAATGTTTCCTCCATGTAGGAGG - Intergenic
1121361448 14:93264810-93264832 CACTGTGTCCGGCCTGGTGGTGG - Intronic
1122342872 14:101039795-101039817 TATTGTCTCTTCCCTGATGGTGG - Intergenic
1122864096 14:104595751-104595773 CACAGATGCCTCCGTGATGGGGG - Intronic
1127291638 15:57576204-57576226 CAATGTTGCCTCCCTGAGCGTGG - Intergenic
1128211992 15:65909381-65909403 CCCTGCCTCCTCCCTGGTGGAGG - Intronic
1128599154 15:68980912-68980934 CACTGCTTCCTGCATGATGGAGG + Intronic
1129183121 15:73889361-73889383 CAGTGGCTCCTCCTTGATGGAGG + Intergenic
1129451483 15:75653571-75653593 CACTGTGCCCTCCCAGATGGGGG + Intronic
1134644472 16:15855281-15855303 CACTGTTTGTCCCCTGATTGAGG - Intronic
1135352515 16:21740915-21740937 TAATGTTTCCTCCCTGAGGTGGG - Intronic
1135451003 16:22557037-22557059 TAATGTTTCCTCCCTGAGGTGGG - Intergenic
1135789002 16:25376292-25376314 CAGTGATTCTTCCCTCATGGTGG + Intergenic
1137829387 16:51529239-51529261 AACTGCTTCCTGCCTGATGGGGG - Intergenic
1140286659 16:73609312-73609334 CAGTGTTTGCTCCCTGCTCGTGG + Intergenic
1142315028 16:89338262-89338284 CACTGTGTCCTCCAGGATGTGGG + Intronic
1146209299 17:30929606-30929628 CAGGGTTTCCACCCTCATGGTGG + Intronic
1146471788 17:33130677-33130699 CACTTTTTCCTCCTGGAGGGGGG + Intronic
1147500155 17:40955485-40955507 CACTGCTTTATCACTGATGGGGG - Intergenic
1147805118 17:43125736-43125758 CACTCTTTCCGCCCTAATGGAGG + Intergenic
1147811124 17:43170577-43170599 CACTCTTTCCGCCCTAATGGAGG + Exonic
1148453193 17:47794383-47794405 CTCGATTTCCTCCCGGATGGAGG - Intergenic
1148795056 17:50192924-50192946 CACTTTCTCCTCCCTGCAGGAGG - Intronic
1150278987 17:63918026-63918048 TTGTGTTTCCTCCCTGTTGGAGG + Exonic
1151292034 17:73157239-73157261 CACAGTCTCCTCCCTGGGGGAGG + Intergenic
1153186652 18:2493667-2493689 CATTGTTTCCTCCTTGCTGTGGG - Intergenic
1155073738 18:22337808-22337830 TTCTGTTTCCTCCCTGAGGCTGG + Intergenic
1155369299 18:25080999-25081021 CAGTCTTTCCTTCCTAATGGAGG + Intronic
1155532930 18:26785895-26785917 AACTGTGTGCTCCCTGAGGGTGG + Intergenic
1156831424 18:41496532-41496554 CACTCACTCCTCCCTGAAGGTGG - Intergenic
1157055803 18:44227176-44227198 CACAGTGACTTCCCTGATGGTGG - Intergenic
1158292351 18:55956014-55956036 CACTTTTTCCTTTCTGAAGGTGG - Intergenic
1158433124 18:57409931-57409953 CACTATTTCATTCCTGATGTTGG - Intergenic
1161618730 19:5287102-5287124 CACTGTTTCCTCTCGCTTGGAGG + Intronic
1163161714 19:15468830-15468852 CACTGTCCCCTCCCTGATCCAGG - Intronic
1163611024 19:18301647-18301669 CTCAGTTTCCTCCCTGGTCGGGG - Intergenic
1166173538 19:41049285-41049307 GAATGTTAGCTCCCTGATGGCGG + Intergenic
1166176238 19:41073323-41073345 CACTGGGGCCTCCCTGAGGGTGG + Intergenic
1166985690 19:46659193-46659215 CACCGCCTCCTCCCTGATGCTGG + Intronic
925699585 2:6622063-6622085 CCCTCTTTCATCCCTGATAGTGG + Intergenic
925699651 2:6622592-6622614 CCCTCTTTCATCCCTGATAGTGG - Intergenic
927383259 2:22503294-22503316 CATTTTTTTCTCCCTGTTGGTGG + Intergenic
927803832 2:26126907-26126929 TACTATTTCCTCCCTAAAGGAGG - Intronic
928665497 2:33547240-33547262 CGCTGGTGCCTCCTTGATGGCGG + Intronic
929653067 2:43701439-43701461 CAATGTTTCCTTCCACATGGAGG - Intronic
930033660 2:47072737-47072759 CCCTGTTTCAGCCCTGAGGGTGG - Intronic
931801662 2:65765015-65765037 CACTGTTTCTTCCCTGTGGTTGG - Intergenic
932296547 2:70628405-70628427 CACTGTGGCCTCCTTGAGGGTGG - Intronic
932587463 2:73040542-73040564 CACTGTGTCATCCCTGATCGTGG + Intronic
933368511 2:81386430-81386452 CCCTGTTTCTTCCCTTAGGGTGG - Intergenic
933412298 2:81941390-81941412 CAGTGTTTCCTTACTGAAGGGGG + Intergenic
934570568 2:95369572-95369594 CCTTGTTTCCTTCCTGATGTTGG + Intronic
935221171 2:101014532-101014554 GACTGTTTTTTCCCTGAGGGAGG + Intronic
937307398 2:120880925-120880947 CACATTTTGCTCCCTGGTGGGGG - Intronic
940041131 2:149362054-149362076 CACAGTTTCATTCCTTATGGAGG - Intronic
941328471 2:164145960-164145982 CTCTTTTTCCTAACTGATGGGGG + Intergenic
944901472 2:204221019-204221041 CTCTGTCTCCTCCCTCATGTTGG - Intergenic
945046742 2:205788659-205788681 CACATTTTCCTTCCTGATAGTGG + Intronic
946037721 2:216757056-216757078 CACTGTGTCTTCCATGATGTTGG - Intergenic
946230180 2:218286506-218286528 CTCTGGTTCCTTCCTAATGGGGG - Exonic
948657822 2:239487457-239487479 CATTCTTTCCTCCCTGAAGTGGG + Intergenic
1169512387 20:6278235-6278257 AAAGTTTTCCTCCCTGATGGAGG + Intergenic
1170262555 20:14426759-14426781 CCATTTTTCCTCCCTAATGGGGG - Intronic
1171105103 20:22425911-22425933 CACTCTTTCATCCCTGGTGATGG - Intergenic
1171235409 20:23520438-23520460 CCCTCTTTCCTCCCTGGAGGTGG + Intergenic
1171358537 20:24569024-24569046 CACTGTCTCCTCACAGAGGGTGG - Intronic
1173021022 20:39268476-39268498 CTTTGTTTTCTCCCTGAGGGAGG - Intergenic
1173704596 20:45100782-45100804 CACTGCTTCCTCCTTGGCGGGGG + Intronic
1173859382 20:46272520-46272542 CCCTATTTCATCTCTGATGGTGG - Intronic
1175100177 20:56573807-56573829 CACTGTGTCCTCACAAATGGGGG - Intergenic
1175513651 20:59553514-59553536 CACTTTTTCCTTTCTGAAGGTGG + Intergenic
1175674785 20:60937164-60937186 CATTCTGTCCGCCCTGATGGGGG - Intergenic
1178242490 21:30918658-30918680 AAATGTTTCCTCACTGATGGAGG + Intergenic
1178252954 21:31022015-31022037 CACTCTTTCCTTCCTGTTGATGG + Intergenic
1178402056 21:32295351-32295373 CCCTGATTCCTCCCTGGGGGTGG + Intronic
1178664940 21:34538392-34538414 CACTGTGTCCTCCCTCAGGATGG - Intronic
1181023268 22:20114239-20114261 CACTGTTTGCTCACTGCTGCAGG - Intronic
1182285774 22:29245980-29246002 CACTGTGACCACCCTGAGGGTGG - Intronic
1182378859 22:29870163-29870185 CACTGTGTCCTCCCTTATCAGGG - Intergenic
1185164534 22:49253124-49253146 AACTATTTCCTCCCTGATTGTGG - Intergenic
950625107 3:14239969-14239991 CTCTGTTTCCTTCTTGATGTTGG + Intergenic
950770594 3:15307774-15307796 CACGGTCACCTCCCTGGTGGTGG + Intronic
952868184 3:37872468-37872490 CAGTGCTTCTTTCCTGATGGGGG - Intronic
954318290 3:49813162-49813184 CACTGTGTCCACCCAGGTGGTGG - Exonic
954637334 3:52078217-52078239 GACTTCTTTCTCCCTGATGGTGG - Intronic
957406474 3:79779028-79779050 CACTTTTTCCTTTCTGAAGGTGG - Intergenic
959159752 3:102708782-102708804 AACTGTTCCCTCCCTAGTGGAGG + Intergenic
959986519 3:112579273-112579295 AACTGTTTCCTCCCTTAGAGCGG + Intronic
961323709 3:126097126-126097148 CCATGATTCCTCCCTGAGGGTGG + Intronic
962045480 3:131755325-131755347 CACTGTCTCCTCCCCTATGGAGG - Intronic
963042452 3:141079660-141079682 CTCTGTTTCCTCCATGAGAGTGG - Intronic
963349958 3:144139823-144139845 CCCTGTTTCCTCGAGGATGGAGG + Intergenic
963955670 3:151251062-151251084 CACTGTTCCCTCCATGATTAAGG + Intronic
964193962 3:154040060-154040082 CACTGGGGCCTCCCTGAGGGTGG + Intergenic
965469418 3:169072427-169072449 CACTGTTTCCTGCCTGACTGTGG - Intergenic
967878388 3:194281939-194281961 CAGTGTTTCCTCCCAAATAGAGG - Intergenic
968760863 4:2442299-2442321 TACTGCTTCCTCCCTCAAGGGGG - Intronic
972377200 4:38483642-38483664 CACTGGGTCCTCCTTGAGGGTGG - Intergenic
972840368 4:42923148-42923170 CACTCCTCCCTCCCTTATGGAGG - Intronic
974453246 4:62093826-62093848 GACTGCCTCCTCCCTCATGGTGG - Intergenic
975269683 4:72417254-72417276 CACTGTTTCTTCCCTGAGTCAGG - Intronic
978079225 4:104571564-104571586 CATTGTTTTCACCCTGCTGGAGG - Intergenic
981670359 4:147279563-147279585 CAATGCTTCCTCTCTGGTGGGGG - Intergenic
988131188 5:27108441-27108463 CACTGATTCTTCCCTTAGGGTGG + Intronic
989450888 5:41585531-41585553 TACTGTTTCTTCCTTGAGGGGGG + Intergenic
992094072 5:73344114-73344136 CGCTGTTCCCTCCCTGCAGGAGG - Intergenic
993404908 5:87499625-87499647 CACTGTGCCCTCACTGGTGGAGG + Intergenic
993797606 5:92286668-92286690 CACTGGGACCTACCTGATGGTGG + Intergenic
999592054 5:153158864-153158886 CACTGTTTCTGTCCTGTTGGGGG + Intergenic
1001035450 5:168293003-168293025 CTCTCTTTCTTCCCTGATCGGGG + Intronic
1001588276 5:172848238-172848260 CACTGTTTCCACCTTCATGATGG + Intronic
1002205182 5:177557848-177557870 GACTGTCTCCTCCCTGAGGCTGG + Intergenic
1005848812 6:29803272-29803294 CACTGTCTCCCCAGTGATGGCGG + Intergenic
1008801971 6:55379320-55379342 CACTGGGGTCTCCCTGATGGGGG - Intronic
1010654641 6:78497583-78497605 CACTGGTACCTACCTGATGAGGG - Intergenic
1010675112 6:78734150-78734172 CACTGGGTCCTACCTGAAGGTGG + Intergenic
1012244737 6:96913809-96913831 CACTGTCCCCTCCGTCATGGGGG + Intergenic
1016287922 6:142493952-142493974 CACTGGGGCCTCCCTGAGGGAGG + Intergenic
1017261154 6:152389361-152389383 CACTGGTGCCTCCTTGAGGGTGG - Intronic
1019513463 7:1429704-1429726 CCCTGCCTCCTCCCAGATGGAGG + Intronic
1019973011 7:4557453-4557475 AACTGTTTCCTCCCTAACGTGGG + Intergenic
1022298964 7:29084473-29084495 CACTTGTCCCTGCCTGATGGTGG + Intronic
1024799969 7:53065346-53065368 CTCTCTTTCCTCCCTGATTCTGG + Intergenic
1031980557 7:128121815-128121837 CACTATTTCCTCCCTGAGCTAGG - Intergenic
1032457312 7:132083219-132083241 CACTTGTTCCTCTCTGGTGGCGG + Intergenic
1032550611 7:132780867-132780889 CACTGCTTTATCCATGATGGAGG - Intergenic
1035968603 8:4222736-4222758 CACTCTTTCTGCCCAGATGGAGG + Intronic
1037999764 8:23381712-23381734 CAGTGTTTCCTCCCTGAGGTTGG - Intronic
1039876742 8:41592919-41592941 CACTTTTTCCTTTCTGAAGGTGG + Intronic
1040416294 8:47198739-47198761 CACTGTGTCCTCCCTGAGAGGGG - Intergenic
1041085375 8:54251804-54251826 CTCTATTTTCTACCTGATGGGGG + Intergenic
1041451076 8:58007356-58007378 CACTGTTTCCTACCAGACGCGGG + Intronic
1044493400 8:92847348-92847370 CCCTCCTTCCTCCCTTATGGAGG + Intergenic
1045913220 8:107435042-107435064 CACCGTTTCCCTCATGATGGGGG + Intronic
1046724227 8:117656905-117656927 CTCTGTATCCTCAGTGATGGTGG - Intergenic
1047411747 8:124629798-124629820 CCCTGGTTCTTCCCAGATGGAGG - Intronic
1048580434 8:135725944-135725966 CAAGGTTTGCACCCTGATGGGGG - Intergenic
1049005072 8:139849879-139849901 CAGTGTTTCCGACCTGAAGGAGG + Intronic
1049766401 8:144357271-144357293 CTCTGATACCTCCCTGCTGGAGG + Intronic
1056086671 9:83156351-83156373 CACTGTTTGCTACCTGATAAAGG + Intergenic
1057015276 9:91645501-91645523 TACGGCTTCCTCCCTAATGGCGG + Intronic
1059446531 9:114341723-114341745 TGCTGTTCCCTCCCTGATAGGGG - Exonic
1060337084 9:122735296-122735318 CACTGTGGCCTACCTGAGGGTGG + Intergenic
1060520966 9:124293877-124293899 CACAGGTTTCTCCCTGAAGGTGG - Intronic
1061135138 9:128729448-128729470 CGCTGCCTTCTCCCTGATGGTGG + Intergenic
1062506008 9:136876901-136876923 CACTGTCTCCTGCCTGCTGTGGG + Intronic
1062674545 9:137732809-137732831 CATTGTTGCCTCCCTGTGGGAGG + Intronic
1186480411 X:9892570-9892592 CACTGTTTCCACACAGATGTGGG - Intronic
1186611971 X:11146313-11146335 CACTGTTTCCTCCCTGATGGAGG - Intronic
1187568625 X:20477974-20477996 GACTGTTTCCCCTCTGATTGTGG - Intergenic
1188289437 X:28369512-28369534 CACTGGGGCCTACCTGATGGTGG - Intergenic
1190354425 X:49591022-49591044 CACAGTATCCTCCCTGTGGGTGG + Intronic
1190384205 X:49868595-49868617 CTCTGACGCCTCCCTGATGGGGG + Intergenic
1190425572 X:50331930-50331952 CACTTTTTCCTTTCTGAAGGTGG + Intronic
1194169726 X:90566195-90566217 CCCTGATTCCTCCCTTGTGGTGG + Intergenic
1195854926 X:109320688-109320710 CACTGGGGCCTCCCTGAGGGTGG - Intergenic
1196540600 X:116902483-116902505 CACTTTTTCCTCTCTGGTGCTGG - Intergenic
1196832613 X:119787994-119788016 CTCTGTGTCCTGCCTGATGGTGG - Intronic
1200515965 Y:4143970-4143992 CCCTGATTCCTCCCTTGTGGTGG + Intergenic
1201749789 Y:17420306-17420328 CATTGTTTCCTACCTGAAGAAGG - Intergenic
1202082413 Y:21097758-21097780 CTCTGTTTTCTCACTGATGTAGG - Intergenic