ID: 1186616885

View in Genome Browser
Species Human (GRCh38)
Location X:11198138-11198160
Sequence CCTTCCAAAAATGAGGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 297}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186616885_1186616890 6 Left 1186616885 X:11198138-11198160 CCCCACTCCTCATTTTTGGAAGG 0: 1
1: 0
2: 0
3: 26
4: 297
Right 1186616890 X:11198167-11198189 AACATCACAATATAATCAACAGG 0: 1
1: 0
2: 1
3: 16
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186616885 Original CRISPR CCTTCCAAAAATGAGGAGTG GGG (reversed) Intronic
900782553 1:4627513-4627535 CCTTCCAAAAAGGACCAGCGGGG + Intergenic
901210715 1:7524544-7524566 TCTTCCACAGATGAGGAATGGGG - Intronic
902611735 1:17601949-17601971 CCTTCTAAAGATGAGGAGCCTGG + Intronic
903752920 1:25640307-25640329 CATTCCAAGAATGAGGATGGGGG - Intronic
904754153 1:32758889-32758911 CCTTCCCAAACTGAGGGGTTAGG + Intronic
905249281 1:36637756-36637778 ACTTCCAAGCAGGAGGAGTGGGG + Intergenic
906034518 1:42741965-42741987 CCCTCAAAAAGGGAGGAGTGTGG - Intergenic
906419274 1:45650311-45650333 CCTTTCAAAATTGACAAGTGTGG - Intronic
907630762 1:56079650-56079672 CCTTCTTAAAATAAGGAGTGAGG - Intergenic
908638592 1:66196449-66196471 CCTTCAAAAAGTGAGGACTGTGG + Intronic
908792195 1:67793969-67793991 CCATCCAAAACGGAGGAGGGGGG + Intronic
910665634 1:89723279-89723301 ACTACCAAAAATGAGGAGAGAGG - Intronic
911236401 1:95417034-95417056 ATTTACAAAAATGAGGAGTAGGG + Intergenic
912418774 1:109529695-109529717 CCTCTGTAAAATGAGGAGTGAGG + Intergenic
915358679 1:155272593-155272615 CCTCCCCAAATTGAGGAGGGTGG + Intronic
916428869 1:164708549-164708571 GTTTCCAAAAAGGAGGAGGGAGG - Intronic
917197603 1:172483058-172483080 CATTTTAAAAATGAGAAGTGGGG + Intergenic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
919376920 1:196806692-196806714 CCTGCCAAAAATAAAGACTGGGG + Intergenic
920862806 1:209724326-209724348 TCTTCCAAAAAGAAGGGGTGGGG - Intronic
923677919 1:236096265-236096287 CATTACAAAAATGAAGAGTATGG - Intergenic
924041902 1:239992142-239992164 ACTTCAACAAATGAGTAGTGGGG + Intergenic
924071571 1:240285556-240285578 CATTCCAAAAATGAGAGGTTAGG + Intronic
1064496037 10:15911477-15911499 CCTAAGAAAAATGAGAAGTGAGG - Intergenic
1064647719 10:17476745-17476767 CTTTACAAAAATGAGAAATGTGG - Intergenic
1065545134 10:26811449-26811471 CCTTCCAAAGAAGGGGAGTTAGG + Intronic
1066018360 10:31271077-31271099 CCTTCCTCCACTGAGGAGTGTGG - Intergenic
1067730800 10:48810011-48810033 ACTTTCAAAAATGATGAGTCTGG - Intronic
1069341003 10:67408462-67408484 CCTGACAAAAATGAGGAATGGGG + Intronic
1070011593 10:72480497-72480519 CCATGCAAAACTGAGGAGTGAGG + Intronic
1070205204 10:74252109-74252131 ACATCCAAAAATGAGGGGAGAGG - Intronic
1070523363 10:77274334-77274356 CCTTCCAAAGAAGGGCAGTGAGG + Intronic
1072349998 10:94547452-94547474 CATTCCAAAAACGAGTAATGAGG + Intronic
1075260692 10:120961815-120961837 CCTTCCAAATCTGAGGAATGAGG - Intergenic
1075313066 10:121430902-121430924 CCTGCTGAAAATGAGGAGGGTGG - Intergenic
1075688253 10:124378665-124378687 CCTTCCAAAATTGGGCACTGTGG - Intergenic
1075747560 10:124738233-124738255 GCATCCAAGACTGAGGAGTGAGG - Intronic
1075965375 10:126606668-126606690 CCTTTTAGAAATGGGGAGTGGGG + Intronic
1076113510 10:127879528-127879550 CCTTTGAAAGATGAGGAATGAGG - Intronic
1076412982 10:130264955-130264977 CCTTTGAAAAATGGGGAGGGAGG + Intergenic
1077876235 11:6309619-6309641 TCTTCCAGAAGTGAGGAGTAAGG + Intergenic
1080017647 11:27524334-27524356 CCTTTTAAAAATGAGTAGTATGG - Intergenic
1080134121 11:28834172-28834194 CTTGCAAAAATTGAGGAGTGAGG + Intergenic
1080982837 11:37429162-37429184 CCTTACAAAAACAAGCAGTGGGG - Intergenic
1082118267 11:48350847-48350869 CCTGACAAAAATGAGAAATGGGG + Intergenic
1084551283 11:69843636-69843658 CATTTTAAAAATGAGGAGGGGGG + Intergenic
1087444974 11:98239253-98239275 CACTCCAAAAAAGGGGAGTGAGG + Intergenic
1088066896 11:105730754-105730776 CTTTCCAAAAACAAGCAGTGGGG + Intronic
1089632578 11:119792970-119792992 CCCTGTAAAAATGAGGAGTCAGG + Intergenic
1090405209 11:126472437-126472459 CCTTACAAAAAAGAGGCCTGAGG - Intronic
1090484181 11:127097750-127097772 TCTTCCAAAGATGATGAGAGAGG + Intergenic
1092746231 12:11674952-11674974 CCTTCCATAAATGTTGACTGAGG - Intronic
1092785138 12:12019715-12019737 CCTTCCACAAAAGAGGAGAAAGG + Intergenic
1092816270 12:12314823-12314845 TCTCACAAAAATGGGGAGTGAGG - Intergenic
1092954327 12:13535538-13535560 CCTTTGTAAAATGAGGAGTTGGG + Intergenic
1093777246 12:23090214-23090236 CCTGACAAAAATGAGAAATGGGG - Intergenic
1096381234 12:51159779-51159801 TCTTCCAAATATGAGGAATCTGG - Intronic
1096561281 12:52437705-52437727 TCTTCCACAGATGAGGAGTGGGG + Intergenic
1096803522 12:54126845-54126867 GCTTCCGAAACTGAGGATTGAGG + Intergenic
1097274080 12:57799787-57799809 CCTGCCAAAAAGGAGGTGAGTGG - Exonic
1097733842 12:63159444-63159466 TTTTCCAAAAATAAGGGGTGGGG - Intergenic
1099220252 12:79905345-79905367 CCTTCAAAAAAAAAGGGGTGGGG - Intronic
1100039372 12:90295276-90295298 CCTTTAATAAATGAGGAATGTGG + Intergenic
1100310376 12:93389540-93389562 TCTTCCAAAAATGAGTAATATGG - Intronic
1103673117 12:122634522-122634544 CCTTACAAAAGGGAGGATTGTGG + Intergenic
1103860890 12:124012820-124012842 CCTTTCAAATGTGATGAGTGCGG + Exonic
1104106651 12:125666504-125666526 CCATCCAAGAGTGACGAGTGGGG + Intergenic
1104247192 12:127055124-127055146 CCTATTTAAAATGAGGAGTGGGG + Intergenic
1105273224 13:18897590-18897612 CCTTCTTAAGATGAGGAATGAGG + Intergenic
1105761468 13:23519295-23519317 CCTTCCAAATTTGAGGACTGGGG + Intergenic
1106415496 13:29543084-29543106 CTTTCCAAGAATAAGGACTGGGG - Intronic
1107251485 13:38368727-38368749 CCTTCCAAACATAGGGATTGAGG + Intergenic
1107358481 13:39593842-39593864 CCTGACAAAAATGAGAAATGGGG + Intronic
1108364377 13:49695276-49695298 GATTCCAACAATAAGGAGTGTGG - Intergenic
1109034290 13:57234785-57234807 TCTGACAAAAATGAGCAGTGGGG + Intergenic
1109142903 13:58737719-58737741 CCTTATAAAAAAGAGGAGTTTGG + Intergenic
1109144976 13:58768259-58768281 CTTTCCATAATTGAGGAGTGTGG - Intergenic
1109565609 13:64111223-64111245 CCTTCCACAAATAAGTATTGAGG - Intergenic
1110430955 13:75422725-75422747 CCTAGTAAAACTGAGGAGTGAGG + Intronic
1110790000 13:79577120-79577142 CCTGACAAAAATGAGCAATGGGG - Intergenic
1113971418 13:114194016-114194038 CCTTCCAAAGGTGACTAGTGAGG - Intergenic
1114514511 14:23289380-23289402 ACTGCCAAGAATCAGGAGTGGGG + Intronic
1115032679 14:28815515-28815537 CCTTCCAAAAATGAAGAAGTGGG - Intergenic
1115045790 14:28991587-28991609 CCTTGCAAAAATGAGTCTTGAGG - Intergenic
1115155786 14:30337402-30337424 CCTCCCAAAAATGAGGAATAAGG + Intergenic
1116920759 14:50571127-50571149 GCTTCCAACAATGAGAGGTGGGG + Intronic
1117292578 14:54347843-54347865 TCTTCCAAAAATGGCAAGTGGGG - Intergenic
1118346420 14:64944454-64944476 AGTTCCCAAGATGAGGAGTGTGG + Intronic
1118688013 14:68310956-68310978 CCATGCAAAGATGAGGTGTGTGG - Intronic
1119148536 14:72337538-72337560 CCATCCAAACATGAGCAGTGAGG + Intronic
1120495414 14:85228487-85228509 ACTCACAAAAATGGGGAGTGAGG - Intergenic
1120587970 14:86339316-86339338 CCTACCAAAAAGGTGGAGGGTGG - Intergenic
1122195123 14:100078989-100079011 CTTTCCAGGAAGGAGGAGTGTGG + Intronic
1122367372 14:101202087-101202109 TCCTCCTAAAATGACGAGTGAGG - Intergenic
1123451347 15:20363564-20363586 CCTTCCTAAAATCAGGAATAAGG + Intergenic
1123981271 15:25606786-25606808 CCTTCCAGAACCCAGGAGTGAGG - Intergenic
1126343682 15:47670727-47670749 CCCTTTAAAAATGAGGAGTCAGG - Intronic
1126407843 15:48340052-48340074 CTTTCAAATAATGAGGAGTATGG + Intronic
1126428003 15:48550333-48550355 CTTTCCCAAAATAAGAAGTGTGG - Intronic
1128313882 15:66647876-66647898 CCCTCCTAAAGTGAGGAGGGGGG - Intronic
1130512982 15:84604372-84604394 CCTTCCAAGGTAGAGGAGTGTGG + Intronic
1131181146 15:90240951-90240973 CCTCCCAACAATGAGGACTGGGG + Exonic
1131294795 15:91137797-91137819 TCTTCCAAAAGTGACCAGTGAGG - Intronic
1134250980 16:12573684-12573706 CCTTGCAAAAATTGGGACTGAGG + Exonic
1134340650 16:13342158-13342180 GCTTGGAAAAATGAGTAGTGTGG - Intergenic
1134343252 16:13365021-13365043 TCTTCCAAAAATGATGATGGTGG + Intergenic
1138392874 16:56682990-56683012 CCTTCCCAAAATGAAGGGAGAGG + Intronic
1139945764 16:70640853-70640875 ACATCCCAAAATGGGGAGTGGGG - Intronic
1140050431 16:71476047-71476069 CCTTTCATATGTGAGGAGTGTGG - Exonic
1141295047 16:82759897-82759919 CCTTTAAAAAATGTGGATTGGGG - Intronic
1141887027 16:86899206-86899228 TCTTCCAGAAATGAGGCCTGAGG + Intergenic
1143265720 17:5635663-5635685 CCTTCCAGGAAGGAGGTGTGAGG - Intergenic
1143425733 17:6835758-6835780 CCTTCTAGAAATGAGAAATGGGG - Intergenic
1144712602 17:17412063-17412085 CCATCCATAAAGGAGGAGAGGGG + Intergenic
1144937582 17:18912732-18912754 CATTCCAAAAAGGAGAAGTGAGG + Intronic
1147218269 17:38913284-38913306 GGTTCCAAAAATGAGCAGAGAGG - Intronic
1147351910 17:39854775-39854797 CATTAGAAAAATGGGGAGTGAGG + Intronic
1147771521 17:42871446-42871468 CCTTCCAAAGACCAGGAGAGAGG - Intergenic
1147974699 17:44240083-44240105 CTCTCCAACAAAGAGGAGTGGGG + Intergenic
1148408914 17:47447512-47447534 ACTTCCAAAAATGAGGTTTCAGG - Intergenic
1154027053 18:10717756-10717778 CCCTCCTAAAATGAAGAGTTTGG + Intronic
1154293085 18:13127504-13127526 CCTTCCAAAACAGGAGAGTGTGG - Intergenic
1155007650 18:21742105-21742127 CCTTCCCAAGAGGAGGAGTCGGG - Intronic
1156553821 18:38045317-38045339 CCTTCAATAGGTGAGGAGTGGGG + Intergenic
1159085713 18:63789216-63789238 CTTTCCTAAAATGAGGGGTCAGG - Intronic
1159335331 18:67057134-67057156 TCCTTCAAACATGAGGAGTGTGG - Intergenic
1159342298 18:67151118-67151140 CCTTCCAGAAAAGAGAAGGGAGG - Intergenic
1160056479 18:75486813-75486835 TCTTCCAAAATTGAGGAGGAGGG - Intergenic
1160218361 18:76953900-76953922 CCTCCCAAGCATGAGGAGTGTGG - Intronic
1163747820 19:19058480-19058502 TCCTCCTAAAGTGAGGAGTGGGG + Intronic
1164092569 19:21972098-21972120 CCTTACAAATATGAAGAATGTGG - Exonic
1164133819 19:22392420-22392442 CCCTACAAATGTGAGGAGTGTGG - Exonic
1164164989 19:22664339-22664361 CCCTACAAATGTGAGGAGTGTGG + Exonic
1164223757 19:23223130-23223152 CCTTACAAATGTGAAGAGTGTGG - Exonic
1164298117 19:23934298-23934320 CCTTACAAATGTGAGGAATGTGG + Exonic
1164311952 19:24053815-24053837 CCTGCCAAAAGGGAGGATTGCGG + Intronic
1165193618 19:34083969-34083991 CCTTAGGAAAATGAGTAGTGAGG + Intergenic
1166582347 19:43913499-43913521 CCATACAAATGTGAGGAGTGTGG - Exonic
1166582452 19:43914255-43914277 CCATACAAATGTGAGGAGTGTGG - Exonic
1166582497 19:43914675-43914697 CCATACAAATATGAAGAGTGTGG - Exonic
1166587851 19:43967015-43967037 CCTTTCAAATGTGAAGAGTGTGG + Exonic
1166590869 19:43997388-43997410 CCATCCAAATGTGAGGATTGTGG + Exonic
1166594392 19:44032692-44032714 CCATACAAATGTGAGGAGTGTGG + Exonic
1166594418 19:44032944-44032966 CCATCCAAATGTGAGGACTGTGG + Exonic
1166600190 19:44087006-44087028 CCTTACAAATGTGAGGAGTGTGG + Exonic
1166602250 19:44107187-44107209 CCATACAAATGTGAGGAGTGTGG + Exonic
1166609381 19:44176514-44176536 CCATACAAATGTGAGGAGTGTGG + Exonic
1166615074 19:44236489-44236511 CCTTACAAATGTGAAGAGTGTGG + Exonic
1166747710 19:45149577-45149599 CCTTCAGAAAATCAGGAGCGCGG - Intronic
1167845115 19:52156424-52156446 CCTTACAAATGTGATGAGTGTGG - Exonic
1167882606 19:52473381-52473403 CCTTACAAATATAATGAGTGTGG - Intronic
1167923067 19:52799251-52799273 CCTTACAAATGTGATGAGTGTGG - Exonic
1168241069 19:55089150-55089172 CCTACTAAGAATGAGGGGTGGGG - Intergenic
924981377 2:224920-224942 CCTGCCAAAAAAGAGGAGAGTGG + Exonic
925111396 2:1341411-1341433 CCTCACAGAAAGGAGGAGTGGGG + Intronic
925444534 2:3916211-3916233 CCTTCCATAACTGAGCACTGTGG - Intergenic
928207372 2:29295747-29295769 CCTTCAAAAAATGAGGACAGAGG - Intronic
929216754 2:39422373-39422395 GTTTCCAAACATGAGGAGTTTGG - Intronic
929241185 2:39655326-39655348 CCTGACAAAAATAAGCAGTGGGG + Intergenic
930063885 2:47312813-47312835 CCTTCCCTAAATCAGGGGTGGGG + Intergenic
930618040 2:53614455-53614477 TCTTCCAAATATAAGGAGTCTGG - Intronic
930712725 2:54564362-54564384 TTTTCCAAGAATGAGGAGTGAGG - Intronic
932667606 2:73709541-73709563 CCTTGCACAAATTAGGAGAGGGG - Intergenic
933561547 2:83893276-83893298 GCTTCCAAGATTTAGGAGTGGGG - Intergenic
933691165 2:85180644-85180666 ACTTCCTAAAGTGAGGATTGAGG + Intronic
937010155 2:118555581-118555603 CTTTTTAAAAATGAGGTGTGGGG + Intergenic
937569469 2:123338226-123338248 CCTGGCAAAAATGAGCAATGGGG + Intergenic
938756788 2:134387967-134387989 TCTTCCAATAATGAGAAGTCAGG + Intronic
939329240 2:140736604-140736626 CCTGACAAAAATGAGAAATGTGG + Intronic
941623537 2:167805592-167805614 CCTGACAAAAATGAGAAATGGGG - Intergenic
941658628 2:168171402-168171424 CCCTACAAATATGAGGAGTTGGG + Intronic
944473555 2:200081130-200081152 CCTTGCAAAAATTAGGACTTGGG + Intergenic
944982042 2:205132442-205132464 CCTTTCAAAGATGAAGAGTTTGG - Intronic
1169001516 20:2171251-2171273 CCCTCCAAAAAAGAGGAGGATGG + Intronic
1169964229 20:11197067-11197089 CCCTCCAAAGATGTTGAGTGAGG - Intergenic
1170850795 20:20002852-20002874 CCTTCCAAGCATGGGGAGTATGG - Intergenic
1170919543 20:20664386-20664408 CATTAAAAAAATGAGGAGTCCGG - Intronic
1170991368 20:21304292-21304314 CCTTCAAAAACTAAGGAGTGAGG - Intronic
1173672102 20:44805932-44805954 CTGTCCAAAAATGGGGAGCGGGG + Intronic
1173898586 20:46569761-46569783 CCTTGCAAAAATGGGAGGTGGGG + Intronic
1174494909 20:50931992-50932014 CCTGCCTTAAATGAGGTGTGAGG + Intergenic
1175300726 20:57941009-57941031 CCTTCCGCAGAGGAGGAGTGTGG - Intergenic
1175900789 20:62359185-62359207 CCTCCCTCAGATGAGGAGTGAGG - Intronic
1176188974 20:63798261-63798283 CCTGACAAAAATAAGGAATGGGG - Intronic
1177050718 21:16229438-16229460 CCTGACAAAAACGAGCAGTGGGG + Intergenic
1177417995 21:20818974-20818996 CCTCCCAAAACTCAGGAGAGGGG - Intergenic
1177933942 21:27318864-27318886 CCTTGCAAAATAGAGTAGTGAGG - Intergenic
1179655430 21:42841787-42841809 CCTTCTTAAAATGTGGAGTCTGG - Intergenic
1179985713 21:44919407-44919429 CCTTCCTAAAATGTGGAGTCTGG + Intronic
1180216487 21:46326682-46326704 CCTTTCAAAAGTGAGGAAAGAGG + Intronic
1180961555 22:19764604-19764626 CCTGCATAAAATCAGGAGTGGGG - Intronic
1181521975 22:23453724-23453746 CATTCCAAAAAAGAAGAGTAGGG - Intergenic
1183383970 22:37504379-37504401 CATTCCACAAATGAGAAGTAGGG + Intronic
1183500349 22:38175116-38175138 CCTTCCAAAGGGGAGGAGAGGGG - Intronic
1184246484 22:43238254-43238276 CCATCAGAAAATGAGGAGTCAGG - Intronic
949565853 3:5244004-5244026 CCTGACAAAAATAAGCAGTGGGG + Intergenic
950782961 3:15408349-15408371 TGTTCAAAAAATGAGGACTGAGG + Intronic
951911840 3:27758623-27758645 CCTTATAAAAATGAGAAGTTTGG + Intergenic
952758888 3:36896514-36896536 CCTTCCAAAAAGGAGTACTTTGG + Intronic
954223442 3:49168103-49168125 CCTTCCAGACATGAGAACTGGGG + Intergenic
955742814 3:62110142-62110164 ACTACCAAAAATGGGGAGGGAGG - Intronic
955775928 3:62432989-62433011 ACTTCCAAAAATATGAAGTGGGG - Intronic
956327678 3:68071386-68071408 CCTCCCAAACATGAGAATTGTGG + Intronic
957368359 3:79256473-79256495 TCTTCCATAAATGTGGAATGAGG + Intronic
959031661 3:101307256-101307278 CCTACCAAAAATGAGGCTTTTGG - Intronic
959674206 3:109016392-109016414 CCTTCCTATAAAGAGGAGTCAGG - Intronic
960219901 3:115094105-115094127 CCTTCTAGAAATGAGGTGAGGGG + Intronic
961700202 3:128737994-128738016 CCTTAAAAAAAAGGGGAGTGGGG - Intronic
962003141 3:131321228-131321250 TCTTCCAAAAATAAGCAATGGGG + Intronic
962847623 3:139285833-139285855 CCTTCCCACAATGAGGACTCAGG + Intronic
962997098 3:140641004-140641026 GCTGACAAAAATGAGCAGTGGGG - Intergenic
964562706 3:158015629-158015651 CCGTCAATAAATGAGGAGGGAGG - Intergenic
965106436 3:164361277-164361299 TTTTCCATAAATGAGGTGTGGGG - Intergenic
965218942 3:165901609-165901631 CCTGACAAAAATGAGAAATGGGG - Intergenic
965982201 3:174706901-174706923 CCTGACAAAAATGAGAAATGGGG - Intronic
968116140 3:196091390-196091412 ACTTCCAAAAATGACCAGTGGGG - Intergenic
968398977 4:271502-271524 CCTTACAAATGTGAAGAGTGTGG - Exonic
968416629 4:442359-442381 CCTTACAAATGTGAAGAGTGTGG - Exonic
968416645 4:442527-442549 CCTTACAAATGTGAAGAGTGTGG - Exonic
968416659 4:442695-442717 CCTTACAAATGTGAAGAGTGTGG - Exonic
968416711 4:443283-443305 CCTTACAAATGTGAAGAGTGTGG - Exonic
968742029 4:2335936-2335958 CCTTGCACATATGAGGACTGGGG - Intronic
970846868 4:20550545-20550567 CCTTTTATAAATGTGGAGTGAGG - Intronic
970986194 4:22161517-22161539 CCTGACAAAAATAAGGAATGAGG + Intergenic
971448062 4:26773729-26773751 CCTGACAAAAACGAGGAATGGGG - Intergenic
971659042 4:29388519-29388541 CCTTCCAAGAATCAGGAATCAGG - Intergenic
971767916 4:30857591-30857613 CATCCCTAAAATGAGGAGTCTGG - Intronic
975007759 4:69311859-69311881 CCTGACAAAAATAAGGAATGGGG - Intronic
975060229 4:69988117-69988139 CCATCCAAAAATGAGAAGGTGGG - Intergenic
977755529 4:100667210-100667232 CCTGACAAAAATGAGAAATGGGG - Intronic
978206601 4:106087825-106087847 CCTGACAAAAACGAGCAGTGGGG + Intronic
978419651 4:108517119-108517141 CCTGACAAAAATGAGCAATGGGG + Intergenic
978848409 4:113303472-113303494 CTTTCCAAAAAGGAGCAGTGGGG + Intronic
979718555 4:123870678-123870700 AGTTCCAAAAATGTGGAGGGTGG - Intergenic
981671990 4:147297337-147297359 CCTGACAAAAATGAGCAATGGGG + Intergenic
987104001 5:14618949-14618971 CATTCCAGGGATGAGGAGTGGGG - Intergenic
987720936 5:21631842-21631864 CCTTCAAAGAATGAGGACTATGG - Intergenic
988780854 5:34520738-34520760 CCTACCAACAATGTGAAGTGAGG + Intergenic
988971716 5:36475173-36475195 CCTGACAAAAATGAGAAATGGGG + Intergenic
989583264 5:43053331-43053353 TCTTCCAAAGATGATGAATGGGG - Intergenic
991161828 5:63512158-63512180 CCTTACAAAAATAAGCAATGGGG + Intergenic
991225461 5:64265491-64265513 CCTGACAAAAATGAGCAATGGGG - Intronic
991899050 5:71438455-71438477 CATTCTAATAATGGGGAGTGGGG + Intergenic
991987598 5:72306114-72306136 ACTTGCAAAAATGATGAATGAGG - Intronic
992492843 5:77261793-77261815 CCTTCTAAAAGTCAGGAGTAAGG - Intronic
993043622 5:82842998-82843020 CCTGACAAAAATGAGCAATGGGG - Intergenic
993581378 5:89665864-89665886 CCTACCAAAAATGTGGAAGGGGG - Intergenic
994210580 5:97084025-97084047 CTTTACAAAAATGAGGAATTTGG - Intergenic
996268422 5:121572403-121572425 ACTTCCAAAATGGTGGAGTGAGG + Intergenic
996755214 5:126927822-126927844 CCTGCCAAAAATAATGGGTGAGG + Intronic
997148864 5:131469508-131469530 CCTAAAAAAAATTAGGAGTGTGG - Intronic
998947449 5:147354924-147354946 CCTATCCAAAAGGAGGAGTGTGG - Intronic
1000999952 5:167996126-167996148 CTTTCCAGAAATGAGCAGTTTGG + Intronic
1006179927 6:32148682-32148704 ACTTGCAAAAAACAGGAGTGTGG + Exonic
1006776599 6:36597610-36597632 ACTTCCAAATATGAGGAAAGGGG - Intronic
1008867409 6:56229632-56229654 CAATCCTAAAATGAGGAATGTGG - Intronic
1009759180 6:67981140-67981162 CCTTCAAAAAATAAGAACTGAGG - Intergenic
1010359062 6:74971460-74971482 CCTTCCAACATGGAGGAGTCAGG - Intergenic
1010552016 6:77235265-77235287 AGTTCCAAAACTGAGGAGTCTGG - Intergenic
1010598043 6:77789131-77789153 CCTGACAAAAATGAGCAATGGGG + Intronic
1011313520 6:86005962-86005984 CCTGACAAAAATGAGAAATGGGG - Intergenic
1011954709 6:93012660-93012682 ACTTCCCAGAATGAGGAATGAGG - Intergenic
1012982319 6:105843586-105843608 CCCTGCTAAATTGAGGAGTGGGG - Intergenic
1013088878 6:106881224-106881246 CCTTCAAGAAATCAGGAGAGAGG + Intergenic
1016079974 6:139843998-139844020 CCTGACAAAAATGAGCAATGGGG + Intergenic
1016929385 6:149388556-149388578 CCTACAAAATATGATGAGTGGGG - Intronic
1017047883 6:150364424-150364446 CCTTCCACAAGTCAGCAGTGTGG + Intergenic
1017677714 6:156830942-156830964 CCTTCAATAATTGAGAAGTGAGG - Intronic
1017792211 6:157811137-157811159 TGTTCCATAAATAAGGAGTGAGG - Intronic
1018355742 6:163013554-163013576 CCTTCTAAAAATGATCACTGAGG + Intronic
1018818503 6:167354527-167354549 CCTTTAATAAATGAGGAATGTGG + Intronic
1022069327 7:26896610-26896632 CCTTAGAAATATCAGGAGTGTGG + Intronic
1022647392 7:32244117-32244139 CATTCCACAAATCAGGTGTGGGG - Intronic
1025792794 7:64706947-64706969 CCTTACAAATATGAAGAATGTGG + Exonic
1025805788 7:64832746-64832768 CCTTACAAATGTGAGGAATGTGG + Intronic
1025822250 7:64977463-64977485 CCTTACAAATGTGAGGAATGTGG - Exonic
1026420422 7:70231173-70231195 CCTTCCAAAATGGCTGAGTGAGG - Intronic
1029548237 7:101222550-101222572 GCTTCCAAGAAAGAGCAGTGTGG - Intronic
1030585225 7:111410352-111410374 CCTACCAAAAAAGTGGAGGGTGG + Intronic
1031804998 7:126297124-126297146 CCTGCCAAAAACAAGCAGTGAGG + Intergenic
1031938871 7:127766144-127766166 TCTTCCAAAGGGGAGGAGTGTGG - Intronic
1033386731 7:140884284-140884306 TCTTCTAGAAATTAGGAGTGTGG - Intronic
1034442148 7:151091206-151091228 CCCTTCAAAGATGAGGACTGGGG + Intronic
1034787349 7:153937231-153937253 CCTTCCAAAAGTGAGGAGGTGGG + Intronic
1035236728 7:157502043-157502065 ACTTCCAAATATGAAGTGTGTGG + Intergenic
1035398526 7:158550374-158550396 GCTTCCAAAAGTGACCAGTGGGG - Intronic
1035682602 8:1499105-1499127 CACTCCAAGAATGAGGAGTGGGG - Intergenic
1036769747 8:11570910-11570932 CCTTTGTAAAATGTGGAGTGCGG - Intergenic
1036984478 8:13512136-13512158 CATTCCAATAATGTAGAGTGTGG + Intronic
1037024377 8:14015089-14015111 CTCTTCAAAAATGTGGAGTGAGG - Intergenic
1038398527 8:27265390-27265412 CCTCCCAAAAAAGAAGAGTCAGG + Intergenic
1040046067 8:42964965-42964987 CCTTCAAACAATAAGGAGGGTGG - Intronic
1040470813 8:47734529-47734551 CCTTGCACAGAGGAGGAGTGTGG + Intronic
1041219876 8:55639488-55639510 CCTGACAAAAATGAGCAATGGGG + Intergenic
1043119192 8:76301183-76301205 CACTCCAAAAATGAGAAGTCTGG + Intergenic
1044028468 8:87204084-87204106 CCTTTGAAGGATGAGGAGTGTGG + Intronic
1044891660 8:96842599-96842621 CCTTCCAAAAATCAGAAAGGGGG - Intronic
1045717123 8:105060313-105060335 CTTTCAGAGAATGAGGAGTGAGG - Intronic
1046436122 8:114191837-114191859 CCTGACAAAAATGAGAAATGGGG + Intergenic
1047090605 8:121571291-121571313 TCTACCAAAAATGAGGAGGTTGG - Intergenic
1047606723 8:126481965-126481987 CCCTGCAAACATAAGGAGTGCGG - Intergenic
1048003444 8:130398873-130398895 TCTTTCAAGAATGAGTAGTGTGG + Intronic
1050838903 9:10121819-10121841 CCCTCCAACCATGAGGATTGAGG + Intronic
1051582499 9:18692964-18692986 CCTTTCAGAAATGAAAAGTGAGG - Intronic
1051922030 9:22277858-22277880 CCTTCCTAAAATTAGGAATGCGG + Intergenic
1055847750 9:80587790-80587812 CCTTCCCAAAGTTAGGACTGGGG + Intergenic
1056463930 9:86835712-86835734 CCTGCCAAAGTTGAGGGGTGTGG + Intergenic
1056646810 9:88419875-88419897 CTTTCCAGAAATCAGGAGAGAGG + Intronic
1058929369 9:109703978-109704000 CCTTTCAAAAGTGACCAGTGTGG - Intronic
1059465082 9:114463892-114463914 CCATCCAGGAATGAGGAGTCTGG - Intronic
1186616885 X:11198138-11198160 CCTTCCAAAAATGAGGAGTGGGG - Intronic
1186791688 X:13005719-13005741 CCTGCCAGGAATGAGGTGTGGGG - Intergenic
1187820703 X:23285017-23285039 TGTTCCCAAAATGAGGAGTGAGG + Intergenic
1189188318 X:39073066-39073088 CATTCCAAAGAGCAGGAGTGAGG + Intergenic
1191756385 X:64597125-64597147 CCTGCCAAAAACGAGAAATGGGG + Intergenic
1192720784 X:73695519-73695541 CCTGCCAAAAATAAGCAATGGGG + Intergenic
1192923336 X:75730770-75730792 CCCTCAAAAAATGAGGAGGAGGG - Intergenic
1194498272 X:94646299-94646321 CATTCCAAAAATGAGAAATAGGG + Intergenic
1196709888 X:118751971-118751993 CCTTCCACCAGGGAGGAGTGCGG - Intronic
1196999796 X:121426565-121426587 CCTTCCAGAACTAAGGGGTGAGG - Intergenic
1197097897 X:122617120-122617142 CCTGACAAAAATGAGCAATGGGG - Intergenic
1197294075 X:124695729-124695751 CTTTCAAAAAATGAAGACTGTGG - Intronic
1197832564 X:130660329-130660351 ACTCCTAAAAATAAGGAGTGAGG + Intronic
1200848214 Y:7853909-7853931 CCTTACAAATATGAAGAATGTGG - Intergenic