ID: 1186618688

View in Genome Browser
Species Human (GRCh38)
Location X:11215179-11215201
Sequence GGTCCCCTGGGCATCCAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 3, 2: 2, 3: 31, 4: 317}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186618670_1186618688 25 Left 1186618670 X:11215131-11215153 CCCTCCTGCCTGGCTGCCCAGCA 0: 1
1: 1
2: 10
3: 102
4: 1910
Right 1186618688 X:11215179-11215201 GGTCCCCTGGGCATCCAGGCGGG 0: 1
1: 3
2: 2
3: 31
4: 317
1186618671_1186618688 24 Left 1186618671 X:11215132-11215154 CCTCCTGCCTGGCTGCCCAGCAG 0: 1
1: 0
2: 9
3: 93
4: 1736
Right 1186618688 X:11215179-11215201 GGTCCCCTGGGCATCCAGGCGGG 0: 1
1: 3
2: 2
3: 31
4: 317
1186618677_1186618688 9 Left 1186618677 X:11215147-11215169 CCCAGCAGGACAGGACACTTGGG 0: 1
1: 0
2: 3
3: 31
4: 261
Right 1186618688 X:11215179-11215201 GGTCCCCTGGGCATCCAGGCGGG 0: 1
1: 3
2: 2
3: 31
4: 317
1186618679_1186618688 8 Left 1186618679 X:11215148-11215170 CCAGCAGGACAGGACACTTGGGG 0: 1
1: 2
2: 2
3: 21
4: 192
Right 1186618688 X:11215179-11215201 GGTCCCCTGGGCATCCAGGCGGG 0: 1
1: 3
2: 2
3: 31
4: 317
1186618673_1186618688 21 Left 1186618673 X:11215135-11215157 CCTGCCTGGCTGCCCAGCAGGAC 0: 1
1: 0
2: 9
3: 62
4: 920
Right 1186618688 X:11215179-11215201 GGTCCCCTGGGCATCCAGGCGGG 0: 1
1: 3
2: 2
3: 31
4: 317
1186618675_1186618688 17 Left 1186618675 X:11215139-11215161 CCTGGCTGCCCAGCAGGACAGGA 0: 1
1: 0
2: 6
3: 103
4: 714
Right 1186618688 X:11215179-11215201 GGTCCCCTGGGCATCCAGGCGGG 0: 1
1: 3
2: 2
3: 31
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186618688 Original CRISPR GGTCCCCTGGGCATCCAGGC GGG Intronic
900130220 1:1084218-1084240 GGTCTCCTGGGGACCCGGGCAGG + Intronic
900151513 1:1181040-1181062 GGCCACCTGGGCTCCCAGGCTGG + Intronic
900176500 1:1293634-1293656 GGTCCCCCGGGCGCCCTGGCGGG - Exonic
900208172 1:1440334-1440356 GGTGTCCTGGGCATGAAGGCAGG - Exonic
900419680 1:2550477-2550499 GGTCCCCTGGGGCCCCATGCTGG + Intergenic
900425543 1:2576794-2576816 GGTCCCCTGGGGCCCCATGCTGG - Intergenic
900433159 1:2612337-2612359 GGTCCCCAGGGCAGCGAGACAGG + Intronic
901322878 1:8350106-8350128 GGCCCCCTGGGGATCCACGATGG + Intergenic
902245263 1:15116646-15116668 GGGTCCCAGGTCATCCAGGCTGG - Exonic
902791027 1:18768162-18768184 TGTCCCCTGTCCATACAGGCTGG - Intergenic
903201974 1:21748713-21748735 TTTCACCTGGGCAGCCAGGCCGG - Intronic
903768861 1:25751562-25751584 GAACCCCTGGGCAGGCAGGCAGG + Intronic
904468067 1:30719502-30719524 GGTCCCTTGGGCATCCACATGGG - Intronic
904799999 1:33085912-33085934 GGTGCCCTGGGCCTCCACGTGGG + Intronic
905037784 1:34929254-34929276 GGGCCCGCGGGCAGCCAGGCCGG + Intronic
905284528 1:36870724-36870746 GGACCCAAGGTCATCCAGGCAGG - Intronic
906943750 1:50277956-50277978 GGTCCCTTGGGTTTCCAAGCTGG - Intergenic
907311762 1:53542815-53542837 GCTACCTGGGGCATCCAGGCAGG + Intronic
910620623 1:89249228-89249250 GTTCCCCCAGGCTTCCAGGCAGG - Intergenic
911068989 1:93817238-93817260 GGGCCACTGGGCATCAAAGCAGG + Intronic
911504987 1:98737732-98737754 AATCCCCTGGGCCTCCAGGTGGG + Intronic
914490930 1:148149655-148149677 GGTCCCCTGGGCCGCCCGGGGGG - Intronic
917357823 1:174144547-174144569 GGTCCCCTGTGCCTCCTGACTGG + Intergenic
917881430 1:179340451-179340473 GGTCTCCTTTGCATCCAGGCTGG - Intronic
917975445 1:180234917-180234939 GTTCCCCGGGCCACCCAGGCCGG - Intronic
918048545 1:180955433-180955455 GGACACCTGGGCATCTAGGATGG - Intergenic
919759683 1:201089677-201089699 GGGCCCCTGGGCCTCATGGCAGG + Intronic
920445438 1:206012638-206012660 TGTCCCCTCAGCATCCAGGTGGG - Exonic
920502319 1:206493143-206493165 GGTGCTCTGGGGATGCAGGCTGG + Intronic
920734913 1:208524786-208524808 GGTACCCTGGGCACTCTGGCTGG + Intergenic
921302344 1:213763311-213763333 GGTCTCCTGGGAATCAAGTCAGG - Intergenic
922078195 1:222268523-222268545 GGTACCAAGCGCATCCAGGCAGG + Intergenic
922696130 1:227731935-227731957 GCTCACCAGGGCCTCCAGGCAGG - Exonic
922891199 1:229062947-229062969 GGGCACCAGGGCAGCCAGGCAGG - Intergenic
923104492 1:230843738-230843760 GGGGCCCAGGGCGTCCAGGCTGG + Exonic
1063365565 10:5488361-5488383 GGTCATCTGGGCAGCAAGGCAGG + Intergenic
1064090373 10:12378153-12378175 GGGCCCCTGGGCAGCCAGGCAGG - Intronic
1065515868 10:26523771-26523793 GGTCTCCTGTGTTTCCAGGCTGG - Intronic
1065644266 10:27818112-27818134 GGATCCATTGGCATCCAGGCTGG - Intronic
1065762413 10:28994473-28994495 GGACCCCTGAGCGTTCAGGCAGG + Intergenic
1065926051 10:30434423-30434445 AATCCCCGGGGCACCCAGGCGGG - Intronic
1068044448 10:51868255-51868277 TGTCCCATGGGCAACCATGCTGG - Intronic
1069158284 10:65054899-65054921 AGTCCCCTGGGCCTTCAGACTGG - Intergenic
1070424829 10:76276168-76276190 GGTCTCCTGTTCACCCAGGCTGG + Intronic
1071477000 10:86033674-86033696 TGGCCACTGGGCCTCCAGGCTGG + Intronic
1072549897 10:96469504-96469526 GGGGCCCTGTGCACCCAGGCTGG + Intronic
1073041858 10:100613219-100613241 GGTGCCCTGGCCAGCGAGGCTGG - Intergenic
1074839997 10:117341477-117341499 AGTCCCCTTGGCATCCATGGGGG + Intronic
1074852073 10:117447100-117447122 GGGCCCCTGGTCATCCAAGCAGG - Intergenic
1075112665 10:119599976-119599998 GGTTCCCTGGGCATCAGGGAAGG + Intergenic
1075643848 10:124084819-124084841 GGTTTCCTGGACATCCAGGTGGG - Intronic
1075725400 10:124608284-124608306 CTTCCCCTGGGCACACAGGCTGG - Intronic
1076162495 10:128256085-128256107 GGATCCCTGGGCATCCTGGTGGG + Intergenic
1076675807 10:132147238-132147260 GGTCCCCTGAGCATCAGAGCAGG + Intronic
1076761655 10:132608833-132608855 GGGCCCCTGGGCCTCCACTCTGG - Intronic
1076851569 10:133095885-133095907 GCTGCCCTGGGCATCGGGGCAGG - Intronic
1077352978 11:2101297-2101319 GGACCCCTCGGCAGCCATGCAGG + Intergenic
1077505294 11:2927336-2927358 GGGCTCCTGGGCCTCCTGGCTGG - Intergenic
1078857910 11:15221435-15221457 GCTCCCCTGTGCATCCTGGGTGG - Intronic
1078877407 11:15412354-15412376 TTTCCCCTGTGCATCTAGGCAGG + Intergenic
1082828499 11:57598195-57598217 GGGCCCCTGGGCTCCCAGGGTGG + Intronic
1083572302 11:63767235-63767257 GGTCTCCTGGGCACACAGGCAGG + Intronic
1083658564 11:64241790-64241812 GGTCTCCGGGGCACCCAGACTGG - Exonic
1084190920 11:67498381-67498403 AGTCCCCTGGGCCTGCTGGCAGG + Intronic
1084624981 11:70299558-70299580 GGTCCCCGGAGCATCCAGAAGGG - Intronic
1084916054 11:72429847-72429869 GGGCCCCTGGCCCTGCAGGCAGG + Intronic
1086509203 11:87538258-87538280 GATCCCTTGGCCATCCAGGGAGG - Intergenic
1087133763 11:94693976-94693998 GGTCCCATGGGCAGCCCAGCTGG + Intergenic
1087588005 11:100147193-100147215 AGTCCCCTGAGACTCCAGGCAGG + Intronic
1089640670 11:119845368-119845390 GGTCCCCAGGGAATCAAGGCAGG - Intergenic
1091119254 11:133043081-133043103 GGACCCCTGGGCAGCCAGGTCGG + Intronic
1091970395 12:4781830-4781852 GGACCCCTGGGAATCAAGGATGG + Intronic
1094721091 12:33064157-33064179 AGTCCACTGGGCAGCCAGACTGG - Intergenic
1096786140 12:54018271-54018293 GGTCCAGTGGGCATCCCGGCTGG - Intronic
1097174330 12:57134085-57134107 GGTCCCCAGGGCCACCAAGCTGG - Intronic
1097191449 12:57221388-57221410 CCTCCCCTGGGCCTCCAGGCTGG - Intronic
1099295395 12:80822779-80822801 GGTGCCATGGGCATCAAGGATGG + Intronic
1100884812 12:99058271-99058293 TGTCACCCGGGCACCCAGGCTGG + Intronic
1101680118 12:106956166-106956188 GCCCCGCTGGGCAGCCAGGCCGG - Intronic
1102344471 12:112150585-112150607 GGTCTCTTTGTCATCCAGGCTGG + Intronic
1102559871 12:113754456-113754478 GGTACCTGGGGCACCCAGGCCGG + Intergenic
1102602246 12:114040196-114040218 GGTCTGCAGGGCTTCCAGGCTGG - Intergenic
1103563537 12:121804459-121804481 GGTCCCCTGGGCGGGCTGGCGGG - Intronic
1103726554 12:123000085-123000107 GGCCCCCGGGGAATCTAGGCGGG - Intronic
1103860918 12:124013118-124013140 GGACCTCTGAGCATCCACGCAGG + Exonic
1104431950 12:128723837-128723859 GGTCTCCTGGGTTTCCTGGCAGG - Intergenic
1104650205 12:130525744-130525766 GATCCCCTGGGCTTCTACGCTGG + Intronic
1104692651 12:130838817-130838839 GGTCCCCAGGGCTTCCTGGGCGG - Intronic
1104918805 12:132279899-132279921 AGGACACTGGGCATCCAGGCAGG - Intronic
1104975157 12:132548907-132548929 GCTGCCCTGGGTTTCCAGGCAGG + Intronic
1106402649 13:29444726-29444748 GGGGCCCTGGGCAGCAAGGCAGG + Intronic
1107853615 13:44593368-44593390 GGTGCTCTTGTCATCCAGGCTGG - Intergenic
1112113087 13:96324061-96324083 AGTCCCCTGTGCCTCCATGCTGG + Intronic
1112800493 13:103104465-103104487 GATCCCCTGAGCCTCCAGGAAGG - Intergenic
1113185256 13:107680070-107680092 GGGCACCTGGGCACTCAGGCAGG - Intronic
1114663877 14:24367530-24367552 GCTCCCAGAGGCATCCAGGCTGG + Intronic
1114842716 14:26284128-26284150 GCTCCCATAGGCAACCAGGCTGG - Intergenic
1119748604 14:77061987-77062009 GGTCACCTGTGTGTCCAGGCTGG + Intergenic
1119772535 14:77229475-77229497 GTTCCCCAGGTCACCCAGGCTGG + Intronic
1121052524 14:90828775-90828797 GGTCCCCTGGGCAGGCAGCAGGG - Intergenic
1122272256 14:100573535-100573557 GGACCCCAGGGCATCCAGCCAGG + Intronic
1122505045 14:102226881-102226903 GGGCAGCTGGGCCTCCAGGCTGG - Intronic
1122776353 14:104118565-104118587 GGTCCCCTGGCCACCCAGGTGGG + Intergenic
1123198403 14:106639055-106639077 GGTCCCCTCCGCGTCCATGCAGG + Intergenic
1124247069 15:28079901-28079923 GAGGCCCTGGGCAGCCAGGCAGG - Intronic
1125589344 15:40844639-40844661 GGCCTCCAGGGCACCCAGGCCGG + Exonic
1126416684 15:48425133-48425155 TGCCCCCTGGGCATCCATGGTGG - Intronic
1129312002 15:74719343-74719365 GGTCCCCAGGTCATCCAGGCTGG - Intergenic
1129997408 15:80018491-80018513 GTTTCCCTCGTCATCCAGGCTGG + Intergenic
1130133161 15:81160502-81160524 GCCTCCCTGGGCAGCCAGGCTGG + Intronic
1130535529 15:84782740-84782762 GGCCTCCTTGGCATCAAGGCTGG - Exonic
1130546112 15:84858346-84858368 GGTCCCCAGGGACTCCAGGGCGG + Exonic
1130925015 15:88378821-88378843 GGTCTCCTGGGCAGCCCGTCAGG + Intergenic
1131150760 15:90046038-90046060 GGGCCCCTGGGAACCCTGGCTGG - Intronic
1131228379 15:90643465-90643487 AGTGCCCTGAGCATCCTGGCTGG + Intronic
1131567693 15:93501812-93501834 CTTCCCCTTGGCATCCAGGAAGG + Intergenic
1132737410 16:1393792-1393814 TGCCTCCTGGGCATCCAAGCTGG - Intronic
1133028462 16:2998642-2998664 GGGGACCTGGGGATCCAGGCAGG - Intergenic
1133078005 16:3295007-3295029 GCTCTCCTGGGCCTCCCGGCAGG + Intronic
1133232211 16:4372125-4372147 GGTCACCTGGGCCGCCCGGCGGG + Intronic
1133246818 16:4454714-4454736 GGGCCCCTGGGTGGCCAGGCGGG + Intronic
1133328474 16:4956836-4956858 GGTCCCCTGGGAGTCCTGGGAGG + Intronic
1133941949 16:10316760-10316782 GGTCCCATGGGAAGCCAAGCTGG + Intergenic
1135517659 16:23149132-23149154 GGGCCCCGGGGCGTCCGGGCCGG - Exonic
1135976078 16:27109724-27109746 GGTCCCGTGAGCAGCCAGGGCGG + Intergenic
1136016142 16:27402400-27402422 GGGCAGCTGGGCCTCCAGGCAGG - Exonic
1136146774 16:28320821-28320843 GGGCCCCTGGGGAGCTAGGCCGG - Exonic
1136349711 16:29698907-29698929 GTTCCACTGGGCATCAAGGGAGG + Intergenic
1137560643 16:49499944-49499966 AGTCCCCTGTCCCTCCAGGCAGG - Intronic
1137708563 16:50551093-50551115 GGTCTCCTTGGCATCCAGTCTGG + Intronic
1139742838 16:69050369-69050391 GGTCTCATGGTCATCCTGGCTGG + Intronic
1141505198 16:84472278-84472300 GGGCCCCTGGGCAGCCAGTGTGG - Intergenic
1141668134 16:85476661-85476683 GGTCACTCTGGCATCCAGGCTGG + Intergenic
1141692910 16:85606651-85606673 GGATCCCAGGGCATCCAGGCTGG - Intergenic
1141955806 16:87370604-87370626 GTGACCCTGGGCATGCAGGCAGG + Intronic
1142131758 16:88434425-88434447 TGGCCCCTGGGCATCCTGTCAGG - Exonic
1142471202 17:164277-164299 TGTCCCCTGGGTCTCCTGGCTGG + Intronic
1142509157 17:383899-383921 GGTCCCCGGTGCAGCCAGGGAGG + Intronic
1142509170 17:383940-383962 GGTCCCCGGTGCAGCCAGGGAGG + Intronic
1142638076 17:1270236-1270258 GGTCCCCGGGGCAGCGTGGCCGG + Intergenic
1144496367 17:15748786-15748808 AGTCCCCTGGGCCTTCAGACTGG + Intronic
1144579801 17:16452030-16452052 GCTCCCCTGAGATTCCAGGCCGG - Intronic
1144605952 17:16666190-16666212 AGTCCCCTGGGCCTTCAGACTGG + Intergenic
1144702086 17:17346720-17346742 GGAAACCTGGGTATCCAGGCAGG - Intronic
1144905213 17:18635913-18635935 AGTCCCCTGGGCCTTCAGACTGG - Exonic
1146256220 17:31392556-31392578 GCTCTGCTGGGCAGCCAGGCTGG + Intronic
1146907334 17:36626158-36626180 TGTCCCCTGGACTTCCAGCCTGG + Intergenic
1147978893 17:44262801-44262823 GGTCCCCAGAGCCTCCAGGTGGG + Intronic
1148063230 17:44850772-44850794 GCTTCCCTGGGGACCCAGGCAGG + Exonic
1149297526 17:55273938-55273960 GGGCCTCTGGGCAGACAGGCAGG - Intronic
1149439629 17:56663665-56663687 ATTCTCCTGGGCATCCAGTCTGG - Intergenic
1149470764 17:56913671-56913693 GGCCACCTGGGCATTCGGGCTGG + Exonic
1149575218 17:57707160-57707182 GCTCCCCAGGGCAGGCAGGCAGG - Intergenic
1149654340 17:58302403-58302425 GGTCCCCAGGGCCCCCAGGTGGG - Exonic
1149828325 17:59849626-59849648 TGTCACCTGGTCAACCAGGCTGG - Intergenic
1149850424 17:60030562-60030584 TGTCCCCTGGGTCTCCTGGCTGG - Intergenic
1149859742 17:60115962-60115984 TGTCCCCTGGGTCTCCTGGCTGG + Intergenic
1150646970 17:66984861-66984883 GGTCCCCAGGGTTACCAGGCTGG + Intronic
1150656296 17:67041937-67041959 AGGCCCCTGGGGAACCAGGCAGG + Intergenic
1151670391 17:75568917-75568939 CAGCCCCTGGGCATCCCGGCTGG + Intronic
1151751869 17:76043704-76043726 GGTCCCACGGGCAGCCAGGGAGG + Intronic
1152519199 17:80845519-80845541 GCTCCCCAGGGGAACCAGGCAGG - Intronic
1152584123 17:81181541-81181563 GGACCCTGGGGCAACCAGGCGGG - Intergenic
1152678900 17:81655713-81655735 GGTCCCTGGGGCATCCAGTGCGG - Intronic
1152798573 17:82320690-82320712 TGTCCCCTGCGCACCCAGGCAGG - Intergenic
1153688613 18:7568646-7568668 GGACCCCCGGGCAGCCGGGCTGG - Intronic
1154197064 18:12274350-12274372 GTTCCTCTGGGCTCCCAGGCCGG + Intronic
1160513915 18:79468091-79468113 GGGACCACGGGCATCCAGGCTGG + Intronic
1160994656 19:1877090-1877112 GGTCCCCTGGGCCGCCCGGGGGG + Exonic
1161112347 19:2477363-2477385 TGTCCCGTGGGCAGCCGGGCTGG + Intronic
1161324829 19:3658570-3658592 GGTCCCCTGGCCTCCCAGGGAGG - Intronic
1162106743 19:8374289-8374311 GGTCCCCTGGGGACACAAGCAGG + Exonic
1162335095 19:10055353-10055375 GGACCCTTGGGCTTCCAGGGTGG - Intergenic
1162447204 19:10730824-10730846 GGGCCACTGAGCAGCCAGGCAGG - Intronic
1162453270 19:10767339-10767361 CCTCCCCTTGTCATCCAGGCTGG + Intronic
1162762628 19:12897509-12897531 GGTCCCCAGGGCCACCAGGCAGG - Intronic
1162883716 19:13680395-13680417 TGTCTCCTGGGAATCCTGGCAGG + Intergenic
1163007874 19:14407763-14407785 GGTCCCCCTGTCACCCAGGCTGG - Intronic
1165330336 19:35138463-35138485 GGGCTCCTGGGCAGTCAGGCTGG + Intronic
1166271598 19:41717835-41717857 TTACCCCTGGACATCCAGGCTGG + Intronic
1167464772 19:49645004-49645026 GGTCACCTGGGGGTCCAGGGGGG - Exonic
1167490845 19:49792120-49792142 GGAGCCCCGGGCATCCAGGGGGG - Intronic
1167595038 19:50422976-50422998 AGGCCCCGGGGCCTCCAGGCTGG - Exonic
1168316977 19:55488779-55488801 GGTCCCTTGGGCTTCTGGGCTGG - Intronic
1168644523 19:58051557-58051579 AGGCCCCTGTGCATCCAGGTAGG + Intronic
925038868 2:714745-714767 GGTCCCTTGAGCATGCAGGCAGG - Intergenic
925040789 2:731871-731893 GGAGCCCTGGCCACCCAGGCTGG + Intergenic
925872889 2:8286036-8286058 TGTTCCCTGGGCATGCAGGAGGG - Intergenic
929000708 2:37344794-37344816 CCTGCCCTGGGCATCCAGGGGGG + Exonic
932225658 2:70038337-70038359 AGTGGCCTGGGCAACCAGGCTGG + Intergenic
932437788 2:71713021-71713043 GGTCCCTTGGCCAGCCATGCAGG + Intergenic
932737314 2:74263490-74263512 GTGTCCCTGGGCATCTAGGCTGG + Intronic
933418147 2:82013732-82013754 GGTCCCCTAGCCATGCAGTCAGG - Intergenic
933727871 2:85436723-85436745 CCTTCCCTGGGCCTCCAGGCAGG - Intronic
933978095 2:87528068-87528090 GGACTCCTGGGCCCCCAGGCAGG + Intergenic
934773665 2:96923820-96923842 GGTCACCTGAGCCTACAGGCTGG + Intronic
934972187 2:98772811-98772833 GTACCCCTGGGGATCCAGGAAGG - Intergenic
936315740 2:111422735-111422757 GGACTCCTGGGCCCCCAGGCAGG - Intergenic
941850134 2:170172244-170172266 GGTCTCCCTGTCATCCAGGCTGG + Intergenic
946412337 2:219521613-219521635 GGTCCCATGGGCAGGCAGGAGGG + Intronic
946694042 2:222333900-222333922 GGACCCCTGGGCATCAAGTATGG - Intergenic
947206478 2:227665998-227666020 GGGCCTCAGGGCAGCCAGGCAGG - Intergenic
947649473 2:231773199-231773221 GGTCTCATTGTCATCCAGGCTGG - Intronic
948587455 2:239028208-239028230 GGTCCCCTGGGCTGCCCAGCAGG - Intergenic
948890508 2:240904993-240905015 GGCCCCATGGGCATCCGGGCTGG - Intergenic
949028633 2:241777863-241777885 GGGCCCCAGGGCAGCCAGGGGGG - Intronic
1168897943 20:1336823-1336845 GGTCCCCCCTGCATCCTGGCCGG + Intronic
1169346149 20:4829456-4829478 GGTCCCCTGGACACACAGGAGGG + Intergenic
1171169745 20:23005201-23005223 GGTCCACTGGGCTTCCATGTGGG + Intergenic
1172033184 20:31995648-31995670 GGTCCCCAGGAGATGCAGGCTGG - Intronic
1172661270 20:36570756-36570778 GATGACCTGGGCAGCCAGGCTGG + Intergenic
1173465275 20:43276047-43276069 GGTTGCTTGGGCATGCAGGCTGG - Intergenic
1175698912 20:61123433-61123455 GCTCCACTCTGCATCCAGGCGGG - Intergenic
1175753481 20:61514918-61514940 TGTGCCCTGGGCCTCCAGGGAGG - Intronic
1175883490 20:62274172-62274194 AGTCCCCAGGGCAACCAGGTGGG - Intronic
1176046883 20:63097398-63097420 ATGCCCCTGGGCAGCCAGGCTGG + Intergenic
1176108598 20:63401011-63401033 GGTCCCCGGGGCTACCAGGCAGG - Intergenic
1176124872 20:63470927-63470949 GGGCCCCTGGGCACCCAGCCTGG - Intronic
1176190069 20:63804288-63804310 GGTGCTCTGGGCACCCAGGAGGG + Intronic
1179082261 21:38182189-38182211 GGTCAACTGGGAATCCTGGCAGG + Intronic
1179491775 21:41745708-41745730 TGTCTCCTCGGCTTCCAGGCAGG - Intronic
1179575282 21:42304768-42304790 GAGACCCTGGCCATCCAGGCAGG + Intergenic
1179630302 21:42673813-42673835 CGTCGCCCAGGCATCCAGGCTGG - Intronic
1180007663 21:45030376-45030398 GTTCCCCTGTGAGTCCAGGCCGG - Intergenic
1180631707 22:17234400-17234422 GGTTCACTGTGCATCAAGGCCGG - Intergenic
1180949802 22:19715832-19715854 GGCCCCTTGGGGAGCCAGGCTGG + Intronic
1181064398 22:20298882-20298904 GGTCCCCAGGCCAGCCAGGTGGG - Intergenic
1181276988 22:21693621-21693643 GGTCCCCTGGGCAGCCTTGGGGG + Intronic
1182273904 22:29172559-29172581 GGTTCCCTGGGCATCAAGCAGGG + Intergenic
1182273920 22:29172631-29172653 GGTTCCCTGGGCATCAAGCAGGG + Intergenic
1183028266 22:35082694-35082716 GGTCCCAAGGGCATGGAGGCTGG - Intronic
1183608253 22:38879660-38879682 GGACCCCTGGGGATCCGAGCAGG + Intergenic
1183662175 22:39227708-39227730 GGCCACCTGGGAATCCAGGACGG - Intronic
1184471354 22:44698060-44698082 TGTCCCCTGGGTGTCCAGCCGGG + Intronic
1185087635 22:48749347-48749369 CCTCCCCTGGCCATCCACGCCGG - Intronic
1185316614 22:50182104-50182126 GGGCACATGGGCATGCAGGCTGG - Intergenic
949845663 3:8367795-8367817 GGTGCCTTGGTCATCTAGGCAGG + Intergenic
950260845 3:11542710-11542732 AGTCCCCTGGGCATCCTCCCGGG + Intronic
951129541 3:19025371-19025393 GTTCTCCTGGGTTTCCAGGCAGG + Intergenic
953492822 3:43364708-43364730 GGTCCCCCAGGGTTCCAGGCGGG + Intronic
953605610 3:44411374-44411396 GCTCCCATGGGAATCCCGGCAGG + Intergenic
953864740 3:46574551-46574573 GTTCCCTTGAACATCCAGGCAGG - Intronic
954106016 3:48410211-48410233 GGTCCTCTGGGCCTCAGGGCAGG - Intronic
954132595 3:48568085-48568107 GGTCCCCGGGGCCTCAAGGTAGG - Exonic
960997523 3:123349787-123349809 GGTACCCTGGTCATCCAGTCTGG - Intronic
961431747 3:126888847-126888869 GGTCCCCTGGGCTTCCGCTCTGG + Intronic
961445426 3:126978815-126978837 GGTCCCCATGTCCTCCAGGCAGG + Intergenic
961738077 3:129014827-129014849 TGGCCCCTCGGCATCCAGGCTGG - Intronic
962399645 3:135047394-135047416 GGTCCTCTGAGAAGCCAGGCTGG - Intronic
967722845 3:192833815-192833837 GTTAGCCTGGGCAGCCAGGCTGG - Intronic
967995344 3:195162057-195162079 GGTCACCCGGTCACCCAGGCTGG - Intronic
968525930 4:1057184-1057206 GGGCCCGTGGGCACCCAGGAGGG + Intronic
969016399 4:4106952-4106974 GTTGCCCTGGGCATCCTGTCTGG - Intergenic
969112181 4:4851063-4851085 GGTCCCCTGGGCACGCAGAAGGG - Intergenic
969436905 4:7193715-7193737 GGGTCCCAGTGCATCCAGGCGGG - Intronic
970163139 4:13209388-13209410 GGCCCACTGGGCAGGCAGGCAGG + Intergenic
970649573 4:18161309-18161331 GGTCAGCTGGGAATCCAGTCTGG + Intergenic
970828536 4:20307290-20307312 GGTCTCCTTGTCACCCAGGCAGG + Intronic
975612928 4:76219194-76219216 GGTGACCTGGGCATCCAGGAGGG + Intronic
975851677 4:78579229-78579251 GATGCCCTGTGCATCCAGTCAGG + Intronic
982042375 4:151409064-151409086 GCTCCCCGAGGCCTCCAGGCAGG + Intergenic
983300083 4:165913982-165914004 TGTCACCCAGGCATCCAGGCTGG - Intronic
983533392 4:168832994-168833016 GGTCCCGTGAGCAGCCAGGCTGG + Intronic
984999369 4:185469618-185469640 GTTTCCCTGGGCAACCAGGAGGG - Intronic
985090455 4:186357734-186357756 AGGCTCCTGGTCATCCAGGCAGG + Intergenic
985108839 4:186526679-186526701 GGTCTCGTTGTCATCCAGGCTGG + Intronic
985552433 5:540467-540489 GGAGGCGTGGGCATCCAGGCTGG - Intergenic
985651144 5:1108306-1108328 TGGCTGCTGGGCATCCAGGCCGG - Intronic
986173790 5:5334695-5334717 GCTCCCCTGGGTGTCCTGGCAGG + Intergenic
987647293 5:20690404-20690426 GGTTTCCTGGAAATCCAGGCTGG + Intergenic
989558183 5:42820880-42820902 GTTTCTCTTGGCATCCAGGCTGG - Intronic
990013679 5:51031285-51031307 GGTCTCCTGGGAATGGAGGCAGG + Intergenic
990493386 5:56322903-56322925 GGTGCCCCAGGCGTCCAGGCAGG - Intergenic
991029806 5:62071147-62071169 GGTCCCCTGGAGAGCCAGACTGG - Intergenic
991617036 5:68507818-68507840 GGGCCCCTGAGCATCCTGTCCGG + Intergenic
991946869 5:71906596-71906618 TGTCCCCTTGGCTTCCAGCCAGG + Intergenic
992027032 5:72680973-72680995 GGTCCCCTGGGCAGCTAGTGTGG + Intergenic
992093253 5:73338331-73338353 GATCCCCAGGGCTCCCAGGCAGG + Intergenic
992629414 5:78666190-78666212 GGACCCCGGGCCAGCCAGGCAGG - Intronic
1000343921 5:160298520-160298542 GCTCCCCTGGGCCTACAGTCTGG + Intronic
1001201086 5:169717531-169717553 TGTGCCCTAGGCATCCTGGCAGG - Intronic
1001316035 5:170641868-170641890 GGCCTTCTGAGCATCCAGGCAGG - Intronic
1001770905 5:174295133-174295155 AGTCCCCTGAGCCTCCAGCCTGG - Intergenic
1002185555 5:177453246-177453268 GGTCCCCCGGTCTGCCAGGCAGG - Intronic
1002210178 5:177594142-177594164 GTTCACCTGGACATCCAGGTAGG + Exonic
1003039598 6:2675041-2675063 GGTCACCTGGGCATTGAGTCTGG + Exonic
1005765307 6:29005457-29005479 GGGCCCCTGGGGTTGCAGGCAGG - Intergenic
1005986330 6:30878017-30878039 GGCTCCCTGGGCCTCCAGACTGG - Intronic
1006568814 6:34983230-34983252 TGTCCCCTGGTCACCCAGACAGG - Intronic
1007790749 6:44306822-44306844 GGACCTCTGGGCACCCAGGCTGG + Intronic
1008379515 6:50825827-50825849 GGTCCCGTGGGCCTCCCGGCAGG - Intronic
1013233120 6:108174788-108174810 GGTCCCCAGGGCCTTTAGGCTGG - Intronic
1017165413 6:151403696-151403718 GGTACCCTTGGCATACAGGTAGG + Intergenic
1019054548 6:169213771-169213793 CCTCCCCTGGGCCCCCAGGCTGG + Intergenic
1019068658 6:169323587-169323609 GATTCCCAGGCCATCCAGGCAGG - Intergenic
1019119627 6:169792719-169792741 GGCACCCTGGGCATCCAGGGTGG + Intergenic
1019321689 7:418924-418946 GCTCTCCTGGCCATCCTGGCTGG - Intergenic
1019329365 7:455122-455144 GGTGCCCTGGGGACCCAGGAGGG + Intergenic
1019361518 7:607207-607229 GGTCACCTGGACCACCAGGCTGG + Intronic
1019476629 7:1247564-1247586 GGACCCCTGAGCCCCCAGGCTGG - Intergenic
1019720656 7:2568609-2568631 GGTGCGCTGGGCTCCCAGGCTGG + Intronic
1019908247 7:4081201-4081223 GCTCATCTGTGCATCCAGGCAGG + Intronic
1020049571 7:5072730-5072752 GGGCCCCTTGGCTTCGAGGCCGG + Intronic
1024299827 7:47878611-47878633 ATTCCCCTGGTCAGCCAGGCAGG - Intronic
1029373330 7:100163157-100163179 GGTCTCCTGGGCATCCTAGAGGG + Intronic
1032017128 7:128387461-128387483 GGACCCAAGGACATCCAGGCAGG + Intergenic
1032192634 7:129773400-129773422 AGTCCCCAGGGCACCCAGGCAGG + Intergenic
1032594321 7:133224434-133224456 GGGCTCCTGGGAATGCAGGCTGG - Intergenic
1035064932 7:156097390-156097412 AGTCCCTGGGGCATCCACGCTGG + Intergenic
1035438301 7:158875771-158875793 GGTCCTCAGTGCATCCAGGAGGG + Intronic
1036899165 8:12658805-12658827 GTTGCCCTGGGCATCCTGTCTGG - Intergenic
1037835801 8:22214110-22214132 GGACATCTGGGCATCCAGACAGG - Intergenic
1037913445 8:22757914-22757936 GGCCCCCAGGGCATCCGGCCAGG - Intronic
1037969366 8:23161069-23161091 TGTGCCCTGGGGATCCAGTCCGG + Intronic
1038006237 8:23432932-23432954 GGTCCCCGGGGCATTCTGGGCGG + Exonic
1038491432 8:27974807-27974829 GGTCCGCTGTGACTCCAGGCAGG - Intronic
1039221896 8:35340795-35340817 GGGCCCCTGAGCTTCAAGGCTGG - Intronic
1039884724 8:41648416-41648438 GGAGCCCTGCCCATCCAGGCGGG - Intronic
1040532325 8:48276013-48276035 GGTGCCCTGTGCATCTGGGCAGG + Intergenic
1042231686 8:66561716-66561738 GGCACACTGGTCATCCAGGCAGG - Intergenic
1048872995 8:138814121-138814143 GGACACCTGGGGAGCCAGGCAGG - Intronic
1049379495 8:142304995-142305017 GGTCCCCGGGGCAGCCCGGCTGG + Intronic
1049571654 8:143372714-143372736 CATCCCCTGGACACCCAGGCCGG - Intronic
1049850501 8:144827707-144827729 CGTCCCCCGGGCCTCCAGGCGGG + Intronic
1050331291 9:4549162-4549184 GGTCCCCTGAGCATCCTTCCCGG + Intronic
1053202973 9:36165238-36165260 GCTCCCATGGACATGCAGGCTGG - Intergenic
1056798859 9:89677545-89677567 TGTCCCCTGGTCATGCATGCCGG + Intergenic
1057133255 9:92669540-92669562 AGTCCGGCGGGCATCCAGGCGGG + Intronic
1057212213 9:93206435-93206457 GGTCTCCTGGGTCCCCAGGCAGG - Intronic
1057953120 9:99385801-99385823 GGTCCCCAGGGTCCCCAGGCTGG - Intergenic
1059446706 9:114342564-114342586 AGTCCCCTGGGGAACCAGGGGGG + Intronic
1059799053 9:117731032-117731054 GGGCCCCTGACCATCAAGGCTGG - Intergenic
1060149838 9:121281603-121281625 GCTTCCCTGGGCAGCCAGGGCGG - Intronic
1060561043 9:124543751-124543773 GGAGCCCTGGGCTTCCAGGACGG + Intronic
1060932060 9:127495441-127495463 GGTCCCCAGGGCTCCCTGGCCGG - Intronic
1061135349 9:128730388-128730410 GGTCCTCTGGGCAGCGGGGCAGG + Exonic
1061288125 9:129635773-129635795 GATTCCCTGGGCCTCCAGCCCGG + Exonic
1061399672 9:130361545-130361567 GGGACCCTGGGCATCATGGCTGG + Intronic
1061906973 9:133703893-133703915 GGTGTCCTGGACACCCAGGCTGG + Intronic
1062516456 9:136939420-136939442 GGTCCCCAGGGCTTCCCAGCTGG + Intronic
1062551984 9:137092312-137092334 GGTCTCCCTGTCATCCAGGCTGG - Intronic
1186356766 X:8799472-8799494 GGTCACCTGGGCATCCAGGCAGG - Intronic
1186357094 X:8800587-8800609 GGTCACCTGGGCATCCAGGCAGG - Intronic
1186378488 X:9033454-9033476 GGTCCCCTGTGCGTCCAGGGGGG - Intronic
1186618688 X:11215179-11215201 GGTCCCCTGGGCATCCAGGCGGG + Intronic
1186795586 X:13044232-13044254 GGTCCCCTGGGCGTCCAGGCTGG - Intronic
1189745188 X:44161570-44161592 GGTCCCCTAGGCCTCCAGTTGGG - Intronic
1190100338 X:47518061-47518083 GGTCCCCGGGCCAGGCAGGCAGG - Intergenic
1192435428 X:71140690-71140712 AGTGCCCAGGGCGTCCAGGCAGG + Exonic
1196828713 X:119759788-119759810 AGTCCCCGGGTCCTCCAGGCCGG - Exonic
1197790344 X:130248363-130248385 GGACCTCTGGGAATCCCGGCAGG + Intronic
1200014407 X:153147542-153147564 GGTCTGCTGGGCGTCCAGGCAGG + Intergenic
1200025195 X:153252412-153252434 GGTCTGCTGGGCGTCCAGGCAGG - Intergenic
1200150873 X:153950836-153950858 GGGCCCCTGGGAAACCAGGCAGG + Exonic