ID: 1186619620

View in Genome Browser
Species Human (GRCh38)
Location X:11224835-11224857
Sequence GGCTGTGTATGTTGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 344}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186619612_1186619620 26 Left 1186619612 X:11224786-11224808 CCTGAGCTGTAGTACTGAAGTGA 0: 4
1: 1
2: 0
3: 6
4: 101
Right 1186619620 X:11224835-11224857 GGCTGTGTATGTTGGGAAGATGG 0: 1
1: 0
2: 3
3: 27
4: 344
1186619616_1186619620 -1 Left 1186619616 X:11224813-11224835 CCTACAGTGACAGGGAGGTAGTG 0: 1
1: 0
2: 2
3: 20
4: 188
Right 1186619620 X:11224835-11224857 GGCTGTGTATGTTGGGAAGATGG 0: 1
1: 0
2: 3
3: 27
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186619620 Original CRISPR GGCTGTGTATGTTGGGAAGA TGG Intronic
900330622 1:2132807-2132829 GTGTGTGTATGGTGGGAAGCGGG + Intronic
901617755 1:10555346-10555368 GACTCTGTATGTAGGGAAGAAGG - Intronic
901748952 1:11394092-11394114 GGCTGGGTCTGCTGGGCAGAGGG - Intergenic
902923241 1:19679627-19679649 GACTCTGGATGTTGGGGAGAAGG + Intergenic
902971558 1:20056176-20056198 GGATGTGTATTTTGGGTGGAAGG - Intronic
903183342 1:21616126-21616148 GTGTGTGTGTGTTGGGAAGAGGG - Intronic
903452870 1:23466512-23466534 GTGTGTGTATGTTGGGATCAGGG - Intronic
903840237 1:26233884-26233906 GCCTGTGCAGGTTGGGAAGCTGG - Intergenic
904602733 1:31682866-31682888 GGATGTTTCTGCTGGGAAGAGGG - Intronic
904775381 1:32902794-32902816 CGCTGTGTGTGTTGGGCAGTTGG + Intergenic
904826336 1:33276139-33276161 GGCTGGGCATGGTGGGAGGAGGG - Exonic
905045186 1:34992335-34992357 GGCTGGGAAGATTGGGAAGATGG + Exonic
905362227 1:37429177-37429199 AGCTGCGTATGGTGGGAAGTAGG - Intergenic
905474007 1:38213240-38213262 GGGTGAGGATGTTGGGATGAGGG - Intergenic
906785352 1:48610855-48610877 GGCTGTGTGTGTGTGGAAGGAGG - Intronic
907053612 1:51345452-51345474 GGCTCTGTATGTAGGGAGGAGGG - Intergenic
907250992 1:53139418-53139440 CCCTGTGTGTGTTGGGGAGAGGG - Intronic
907286449 1:53383590-53383612 TGCTGTGTCTCTTGGGAAAATGG + Intergenic
907491782 1:54813219-54813241 GGCTGTGCATGGTGTGGAGAGGG - Intronic
908044756 1:60156765-60156787 GCCTGTGTATATTTGGAACAAGG + Intergenic
908098200 1:60762814-60762836 GGCTGTGTGTGGTGGGAAGAGGG + Intergenic
909027640 1:70501508-70501530 GGCAAGGTATGTGGGGAAGAGGG + Intergenic
909077143 1:71062764-71062786 TGTTGTGGATGTTGGTAAGAAGG - Intergenic
911157063 1:94647228-94647250 GGCTGTATGTGTTAGGAGGAGGG - Intergenic
912709587 1:111940846-111940868 GGGTGTGTATGTGGGGTGGAAGG - Intronic
914220108 1:145673618-145673640 GGCTGTGTTTGTTGGGCTGCTGG + Intronic
914380045 1:147107506-147107528 GGTAGTTTATGTTGGGCAGATGG + Intergenic
914463981 1:147909765-147909787 GGCTGTGAAAGTTGGAAAGCAGG + Intergenic
914472689 1:147996484-147996506 GGCTGTGTTTGTTGGGCTGCTGG + Intergenic
915093878 1:153445396-153445418 TGCTTTGTAAGATGGGAAGAGGG + Intergenic
915141575 1:153771552-153771574 GCGTGTGTGTGTTGGGAAGGAGG - Intronic
915172386 1:153986955-153986977 GGCTGTGTGTGTTGGGGTGGTGG - Intergenic
916319422 1:163486915-163486937 GGCTGTGATTCTTGAGAAGAGGG - Intergenic
918071040 1:181133554-181133576 TGCTGAGTATAGTGGGAAGAAGG + Intergenic
918316843 1:183329633-183329655 GGCAGTATCTGTTGGGAAGGAGG - Intronic
919304356 1:195811043-195811065 GGATTTGTATGTTTGGAATAGGG + Intergenic
920694852 1:208174432-208174454 GGCTGTGGAGGGAGGGAAGAAGG + Intronic
921182987 1:212645984-212646006 GGCTGGGTTTGGTGGGCAGATGG + Intergenic
921441015 1:215186136-215186158 GGCTGGGTATGGTGGCAAAATGG + Intronic
921793388 1:219315026-219315048 GGGTGTGTATGTTTTGAGGAGGG + Intergenic
922333198 1:224595963-224595985 GCATGTGTATGTTATGAAGATGG - Intronic
922770882 1:228182459-228182481 GGGTGTGTGTGGTGGGGAGATGG + Intergenic
923759583 1:236828851-236828873 ATCTGTGGATGTGGGGAAGATGG + Intronic
923986471 1:239387393-239387415 GGCTGTTGATTTGGGGAAGATGG + Intronic
924668782 1:246102112-246102134 GCCTGTGCGTGCTGGGAAGAAGG - Intronic
1063350815 10:5352941-5352963 GGCTCTGTGTGTGGGGAGGATGG - Intergenic
1065278024 10:24105894-24105916 GGCTGTGCATTGTGGAAAGAGGG + Intronic
1065329412 10:24578868-24578890 TGTTGTGTATGATGGGAAGTGGG - Intergenic
1066013186 10:31212950-31212972 GGCTGGATATGTTTTGAAGATGG + Intergenic
1066270506 10:33818153-33818175 GACTGAGTGTGATGGGAAGAGGG - Intergenic
1067242517 10:44508584-44508606 GCCTGTGTCTGCTGGGGAGAAGG + Intergenic
1070126371 10:73625652-73625674 GGGTGTGTGTGTTGGGAGCAGGG - Intronic
1071792345 10:88968465-88968487 AGCTGTGAATGTTGGTAACACGG + Intronic
1072265223 10:93720809-93720831 GGCCGTTGATTTTGGGAAGAAGG + Intergenic
1074085771 10:110208173-110208195 GGATGTGTATGTTGGGCGGGGGG - Intronic
1074376725 10:112946929-112946951 GGCTCTGCATGTTGGGAAATGGG - Intergenic
1076103090 10:127798012-127798034 GGCTGTGGCTGTTGGGAAGCTGG + Intergenic
1076486133 10:130818939-130818961 GGCTGTGGAAGGTGGGAGGACGG - Intergenic
1077828246 11:5834102-5834124 GGGTGTGAATGTTGAGAAGAAGG - Intronic
1078085544 11:8231257-8231279 CTGTGTGTATGTTGGGAAGCTGG - Intronic
1078573040 11:12475811-12475833 GGCTGTGCATGTTGGGTATCTGG + Intronic
1079549840 11:21681790-21681812 GAGTTTGTATCTTGGGAAGAGGG - Intergenic
1080036864 11:27719883-27719905 GGAGGTGGAGGTTGGGAAGAGGG - Intronic
1080117342 11:28635836-28635858 GACTGTGTATGTTGGGGATAGGG + Intergenic
1080175696 11:29360370-29360392 GGCTGAGAGTGTTGGGTAGAGGG - Intergenic
1080668965 11:34358548-34358570 GGCTGTGTTTGGAGGGAGGAGGG + Intergenic
1081524810 11:43920100-43920122 TGATGTGGCTGTTGGGAAGATGG + Exonic
1082081519 11:48015965-48015987 CACTGAGTATGTTGGAAAGAGGG - Intronic
1082717404 11:56631197-56631219 GTATGTGTATGTTGGTGAGAGGG - Intergenic
1083492454 11:63022872-63022894 GGCTGTTTATCTTGGGCAGGGGG + Intergenic
1084609185 11:70191342-70191364 GTGTGTGTATGTTGGGATGGGGG + Intergenic
1084658060 11:70530779-70530801 GACAGTGTTTATTGGGAAGATGG + Intronic
1084942221 11:72618860-72618882 GGCTGTTTATGTTGGGAGGTGGG - Intronic
1085643965 11:78210587-78210609 GGCTGTGTCCTTAGGGAAGAAGG - Exonic
1085644273 11:78213114-78213136 GGCTGTGTCCTTGGGGAAGAAGG - Intronic
1087273821 11:96140434-96140456 GCCTGTTCATGTTGGGCAGAAGG - Intronic
1088263273 11:107965300-107965322 GTGTGTGTATGTTGGGTGGAGGG + Intergenic
1088512559 11:110593391-110593413 GTGTGTATCTGTTGGGAAGAGGG - Intronic
1088763890 11:112958405-112958427 ACCTGGGTATGTTGTGAAGATGG - Intergenic
1089125123 11:116171487-116171509 GCATGTGTGTGTTGGGGAGAGGG + Intergenic
1089220409 11:116866294-116866316 GGCTGTGGAGGAAGGGAAGAAGG + Intronic
1089542138 11:119195764-119195786 GGTTGAGGATGATGGGAAGAGGG - Intronic
1089862510 11:121602591-121602613 GGTTGTTTATGTTAGGAGGAAGG + Intronic
1090452430 11:126818645-126818667 GTGTGTGTGTGTTGGGAAGAGGG + Intronic
1090893156 11:130945585-130945607 AGCTGTGTATGTGGGGAGCAGGG - Intergenic
1091415612 12:280477-280499 GTATGTGTATGTTAGGAGGAGGG - Exonic
1091455622 12:605234-605256 GGCTGTGCATCATGGGGAGAGGG + Intronic
1091609721 12:1995638-1995660 GTCTGTGTATGCTGGGCAGGAGG - Intronic
1092088006 12:5780793-5780815 GGCTGTGTATATTTTGAAGGAGG + Intronic
1092180840 12:6445569-6445591 GGGTGTGTAGGTGGGGACGATGG + Intronic
1093685642 12:22050691-22050713 TGTTGTGTATGTTGTGAAGGTGG + Intronic
1095207164 12:39451435-39451457 TGGTGTGTGTGTTGGGAAGTAGG - Intergenic
1095376614 12:41536660-41536682 GGCTATGTATGTGTGAAAGAAGG + Intronic
1095993743 12:48060065-48060087 GGGTGTGTGTGTTGTGAAGGAGG - Intronic
1096876552 12:54634378-54634400 GGCTGTGTCTCTTAGGAGGAAGG - Intronic
1097039494 12:56146950-56146972 GATTCTGTATGTAGGGAAGAGGG - Intergenic
1101551436 12:105766110-105766132 GGTTTTGTAAGTTGGGAACAAGG + Intergenic
1101610575 12:106287695-106287717 GGGTGTGTGTGTTGGGAGGTAGG + Intronic
1101742945 12:107515349-107515371 GGCCCTGAATGTTGGGGAGAAGG - Intronic
1102572130 12:113833303-113833325 GGCTGTGGAGGTGGGGAAGCAGG - Intronic
1103193245 12:119020302-119020324 GTCTGTGTATGTTGGGTACAGGG - Intronic
1103535855 12:121633364-121633386 GGCTGTTTATTTTGGGCTGACGG + Intronic
1103789069 12:123456503-123456525 TGCTGTGGGTGTTAGGAAGATGG - Intergenic
1105036977 12:132932198-132932220 TGCTGTGGAGGTTGGGGAGAGGG - Intronic
1105794300 13:23834806-23834828 GGCTGTGTATTTTGGGAACTGGG - Intronic
1108603893 13:52017879-52017901 TGGTGTGTATGTTGGGATGGTGG - Intronic
1110793869 13:79614685-79614707 GCCTGAGTATGTCTGGAAGATGG + Intergenic
1112487737 13:99834998-99835020 CACTGTGTGTGTTAGGAAGAGGG - Intronic
1114166510 14:20224196-20224218 GTCTGTGTATGCTGGGTAGGCGG + Exonic
1115497857 14:34024860-34024882 GGGTGTGTGTGTTGGGGAGGTGG - Intronic
1115905378 14:38197227-38197249 GGCTGTGTGTTTGGGGAAGGAGG - Intergenic
1116338993 14:43698393-43698415 GGCTGTGAATGTGAGGAAGAAGG + Intergenic
1117630313 14:57684203-57684225 GGCGTGGGATGTTGGGAAGAAGG - Intronic
1118138461 14:63053098-63053120 GGGTGTGCTTGGTGGGAAGAAGG + Intronic
1118741414 14:68742132-68742154 GGCTGTTTATGTCTGGGAGAAGG + Intergenic
1119444789 14:74654145-74654167 GGCTTGGCATGGTGGGAAGAAGG - Intronic
1120015707 14:79470986-79471008 GTGTGTGTGTGTTGGGGAGAAGG + Intronic
1120835017 14:89031381-89031403 GGGTGGGTGTGTTTGGAAGAGGG - Intergenic
1121363491 14:93285184-93285206 GACAGTGGAGGTTGGGAAGAGGG + Intronic
1121628877 14:95408304-95408326 GTGTGTGTGTGTTGGGAAAATGG - Intronic
1121648306 14:95535841-95535863 GGCTGTCGATGGTGGGGAGAGGG + Intronic
1122356285 14:101124806-101124828 GTCTGTGTGTGCTGGGAAGGGGG - Intergenic
1124883524 15:33662861-33662883 GGCTGTGGAGGCTGGGGAGAAGG + Exonic
1125071489 15:35559420-35559442 GATTGTGAATGTTGGGAAGAAGG - Intergenic
1125327199 15:38548135-38548157 GGCTGTGTCTGTTTTAAAGAAGG - Intronic
1126301906 15:47206805-47206827 GCCTGTGGATGGTGGGGAGAGGG - Intronic
1126306217 15:47260933-47260955 GGCTTTTTCTGTTGGGAGGAGGG + Intronic
1127681272 15:61300825-61300847 GGCTGTGCATGTATGGGAGAGGG + Intergenic
1128351989 15:66897048-66897070 GGCTGTGTGAGTAAGGAAGAAGG + Intergenic
1128417342 15:67458774-67458796 GGCTGTGAATGCTGTGAACATGG + Intronic
1128935552 15:71743223-71743245 TGCTCTGTGTCTTGGGAAGATGG - Intronic
1129269520 15:74412011-74412033 GTCTGTGTATGGTGGACAGAGGG + Exonic
1133031772 16:3014451-3014473 GGGTGGGGATGTTGGGGAGAGGG - Exonic
1133514188 16:6491970-6491992 GGCTGGATATTTTGGGTAGATGG + Intronic
1134149050 16:11791349-11791371 GGAAGTGTATTTTGGGCAGAGGG - Intronic
1134400115 16:13901955-13901977 GGCTTTGCAAGTTGGGGAGAGGG - Intergenic
1136545330 16:30951089-30951111 GGCTGAGTATTTTGGGAAATTGG - Intronic
1137024706 16:35460902-35460924 GTGTGTGTGTGTTGGGGAGAGGG + Intergenic
1138125567 16:54435705-54435727 AGCTGGGTGTGTTGGGAAGCTGG + Intergenic
1138799287 16:60006974-60006996 AGCTGTGTAAGATGGGAAGCAGG - Intergenic
1139335647 16:66229031-66229053 GGCTGTCCCTGTTGGGATGAAGG - Intergenic
1139558614 16:67728107-67728129 GTCTGTGCAGGCTGGGAAGAGGG - Intronic
1139643601 16:68311106-68311128 CGCTGGGTATGCTGGGAAGGTGG + Intronic
1139722764 16:68870249-68870271 GGCTGGATATGTGGGGAAGAAGG + Intronic
1142139557 16:88466758-88466780 GGGTGTGTATGTGGGGGAGGGGG + Intronic
1142906522 17:3046486-3046508 GACTGTGTATATGAGGAAGAAGG - Intergenic
1144149141 17:12426667-12426689 GGCTGTGTATGTTTGGAGCAGGG + Intergenic
1147999546 17:44379838-44379860 GGATGTGTATGGTAGCAAGATGG - Intronic
1149523597 17:57337194-57337216 GCTTCTGTAAGTTGGGAAGAAGG - Intronic
1150272273 17:63874092-63874114 GAATGTGTGTGTTGGGAAAAGGG + Intronic
1150273629 17:63882277-63882299 GAATGTGTGTGTTGGGAAAAGGG + Intergenic
1150275820 17:63896989-63897011 GAATGTGTGTGTTGGGAAAAGGG + Intergenic
1150277950 17:63911673-63911695 GAATGTGTGTGTTGGGAAAAGGG + Intronic
1150279241 17:63919254-63919276 GAATGTGTGTGTTGGGAAAAGGG + Intergenic
1150972969 17:70051043-70051065 GGCTGCCTGTGTTGGGAAAAAGG + Intergenic
1151375451 17:73685550-73685572 GGATGTATATGTTGGGGAGAGGG + Intergenic
1151891492 17:76953365-76953387 GCCTGTGTATGTGGGGGAGGTGG - Intergenic
1152073336 17:78144844-78144866 GCCTGGGTGTGTTGGGAAGCTGG - Intergenic
1152567195 17:81105604-81105626 GGGTGTGTCTCTTGGCAAGATGG + Intronic
1152588098 17:81198026-81198048 GGCTGTGGGGGTTGGGAAAATGG - Intronic
1152947175 17:83204136-83204158 GGCTGTGTATGGGGGGAAGCTGG + Intergenic
1153915905 18:9743869-9743891 GTCTGTGCCTGTTGGGAAGATGG + Intronic
1155242525 18:23877171-23877193 GGCGGTGGATGTTGTGAGGACGG - Intronic
1155511731 18:26584736-26584758 GGCTGTGTAGGGTGTGATGATGG + Intronic
1155943157 18:31819941-31819963 GTCAGTGTATCTTGGGAACATGG - Intergenic
1157191319 18:45584412-45584434 GGCTTTGTATGTGGGGTTGAAGG + Intronic
1158403055 18:57138703-57138725 GGGTGTGCATGTGGGGCAGAAGG - Intergenic
1158573309 18:58614908-58614930 GGCTGTGTGTGTTGGGGGGGAGG - Intronic
1158909551 18:62046560-62046582 CGCTGTGTATGTGGGGGTGAGGG - Intronic
1160179039 18:76618686-76618708 GGCTGTGTCTTGAGGGAAGAAGG + Intergenic
1162089346 19:8268815-8268837 GCCTTTGTGTGTTGGGGAGAGGG + Intronic
1162858302 19:13486904-13486926 GGCTGCGTGTGTAGGGAAGAAGG - Intronic
1164442931 19:28293138-28293160 GAGTGTGTATTTTAGGAAGATGG + Intergenic
1166424794 19:42668098-42668120 GTGTGTGTGTGTTGGGAAAAGGG - Intronic
1166910868 19:46155381-46155403 GGCTGGGGATGTGGGGAATAGGG + Intronic
1167053479 19:47094600-47094622 GGGTTTGTTTGTAGGGAAGATGG - Exonic
1167637067 19:50661484-50661506 AGCTGTGTGTGCTGGGGAGAGGG + Intronic
1168184752 19:54692570-54692592 GGCTGGGAAGGGTGGGAAGAGGG + Intronic
925047133 2:781041-781063 GGATGTTTCTGTTGGGAAAAAGG - Intergenic
926240585 2:11081610-11081632 GGCTGAGTAACTTGGGCAGATGG - Intergenic
927483834 2:23475257-23475279 GGCTGTGTGTATTCGGAGGATGG + Intronic
928435795 2:31253730-31253752 GGGTGTGTCTTGTGGGAAGAAGG + Intronic
928938842 2:36707400-36707422 GCCTGTGTTTTTTGGGGAGAGGG - Intronic
928955403 2:36861916-36861938 GACTGTGAAGGGTGGGAAGAGGG - Intronic
929445322 2:41996667-41996689 AGCTGTGGAAGTTGGGCAGATGG - Intergenic
929810524 2:45185690-45185712 GTCGGTGTATGTGGAGAAGAGGG - Intergenic
930570226 2:53077226-53077248 GGCTGTTTTTATTGGGAAGGGGG - Intergenic
932110381 2:68993988-68994010 GGGTGTGTGGGTTGGGAAGGAGG - Intergenic
934567374 2:95348079-95348101 GGCTGTGGACTTTGGGAAAAGGG - Intronic
935899723 2:107778499-107778521 GGCTGTGTCTGTTTTGATGAGGG - Intergenic
938035194 2:128028883-128028905 AGCTGTGCATGATAGGAAGAGGG - Intergenic
938120153 2:128627325-128627347 ATCTGTGTGTGTTGGGAAGCGGG + Intergenic
938125332 2:128666994-128667016 GACTGTGTATGCTCGGAAAAGGG - Intergenic
940166183 2:150775407-150775429 GGTTGTGCATGTGGGGGAGAAGG + Intergenic
941553693 2:166948299-166948321 GGCTGTGTATGTGTGGAGGCAGG + Intronic
942485252 2:176432521-176432543 GTGTGTGTATTATGGGAAGAAGG - Intergenic
943717724 2:191170658-191170680 TGCTGTGTATGGTGGAAAGTAGG + Intergenic
945624030 2:212177970-212177992 GTGTGTGTGTGTTGGGAAGAGGG + Intronic
946228652 2:218278440-218278462 GGCCGAGTATTTTGGAAAGAAGG - Intronic
947966948 2:234289842-234289864 GGCTGGGTATGTGGTGAAAATGG - Intergenic
948229828 2:236341744-236341766 TGCTGTGTGTGGTGGGGAGAAGG + Intronic
948351511 2:237344806-237344828 GGCTAGTTCTGTTGGGAAGACGG + Exonic
1169274575 20:4224856-4224878 GTCTCTGTATGGTGGGAGGAGGG - Intronic
1169947539 20:11005392-11005414 GTCTGTGTGTGTTGGCAAGCAGG - Intergenic
1172004499 20:31809465-31809487 TGATGTGTCTTTTGGGAAGAAGG + Intergenic
1173290801 20:41713315-41713337 GTGTGTGTGTCTTGGGAAGAAGG - Intergenic
1173987952 20:47277339-47277361 GGATATGGATGTTAGGAAGATGG - Intronic
1175301843 20:57948534-57948556 GGCTGTGTATACTGAGAAGGAGG - Intergenic
1175519700 20:59592359-59592381 AGCTATGTATGTTGGGACGGGGG - Intronic
1175729732 20:61346191-61346213 GGCTGAGTGTGTCTGGAAGAGGG + Intronic
1176292744 21:5054980-5055002 GGATGTGGATGGTGGGTAGAAGG - Intergenic
1178031339 21:28529869-28529891 GGCTGTGCACGTGGGGCAGAGGG - Intergenic
1178125263 21:29508989-29509011 GGCTTCTTTTGTTGGGAAGATGG + Intronic
1178421134 21:32444308-32444330 GACTGTGACTGCTGGGAAGAAGG - Intronic
1179864516 21:44208670-44208692 GGATGTGGATGGTGGGTAGAAGG + Intergenic
1183189138 22:36310501-36310523 TGCAGTTTGTGTTGGGAAGAGGG - Intronic
1183505227 22:38205021-38205043 GGCTGTGCAGGTGGAGAAGAGGG + Intronic
1184184226 22:42853612-42853634 GACAGTGAATGTTGAGAAGAGGG + Intronic
1184618787 22:45657553-45657575 GGTTTTGTAAGTTGGGAACAAGG - Intergenic
1184900913 22:47445879-47445901 GGCAGTGTCTGTGGGGCAGATGG + Intergenic
1184988876 22:48154287-48154309 GGGTGTGTATTTTGGGGAGCGGG - Intergenic
1185063198 22:48617778-48617800 GGCTGTGTGTTCTGAGAAGACGG + Intronic
949275695 3:2277538-2277560 AGCTGTGAACGTTGGCAAGAGGG - Intronic
949784671 3:7727847-7727869 GACTGTGTATGTTGGGATCTTGG - Intronic
949942976 3:9168943-9168965 AGCTGTGACTGTTGGGAGGAAGG - Intronic
952540378 3:34361063-34361085 TGTTGGGTATGTTGGGCAGATGG + Intergenic
953752417 3:45618819-45618841 GGCTGTGGACGTGGGGAGGAAGG + Intronic
953918385 3:46935265-46935287 GGCTGTGGAGGTTGGGAGGTCGG + Intronic
954493664 3:50931691-50931713 GGCTGAGTATCTGGGGAAGATGG - Intronic
955702495 3:61695940-61695962 GAATGAGTATGTTGGCAAGAGGG + Intronic
956657438 3:71566220-71566242 TGCTTTGCAGGTTGGGAAGAGGG - Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957050258 3:75406229-75406251 GACTGTGACTGCTGGGAAGAAGG + Intergenic
957590029 3:82184859-82184881 GTGTGTGTATGTTGGGATGGGGG + Intergenic
958065674 3:88542471-88542493 GTGTGTGTGTGTTGGGATGATGG + Intergenic
958114369 3:89196270-89196292 AGTTGTGTATGTTGAGAGGAGGG - Intronic
961494005 3:127277347-127277369 GGCTGACTATTTTGGGGAGAGGG - Intergenic
961743783 3:129050426-129050448 GGCTGTGCATGTTGGGGGGCAGG + Intergenic
964626065 3:158761276-158761298 GGCTCTGTGTGTTGGTAGGAAGG + Intronic
965322011 3:167262135-167262157 GGGGATGTATGTTTGGAAGAGGG + Intronic
967389959 3:188946163-188946185 CCTTGTATATGTTGGGAAGAAGG + Intergenic
967415273 3:189210121-189210143 GTCTGTGTGTGTTGGGGGGAGGG + Intronic
968009040 3:195260967-195260989 GGCTGTGGGTGTGGGGATGAGGG - Intronic
969075495 4:4574862-4574884 GTGTGTGTGTGTTGGGAGGAAGG - Intergenic
969206218 4:5648418-5648440 GGCTGCTTGTGTTGGGAAAATGG + Intronic
969247088 4:5942174-5942196 GGTTGTGTATGTAGGAAAGGAGG - Intronic
969488281 4:7484744-7484766 GGTGGTGTGTGTTGTGAAGATGG - Intronic
969848728 4:9940166-9940188 GGCTGTGCATTATTGGAAGAGGG - Intronic
970468702 4:16353532-16353554 GGCTGTGCTTGTAGGGAAAATGG - Intergenic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
971608639 4:28692086-28692108 GGCAGTGCAGGTGGGGAAGAAGG - Intergenic
971630469 4:28986929-28986951 GGCTGTGTGTGTTGGGGGGCAGG - Intergenic
971855810 4:32042172-32042194 GGCTGTGTATTGGGAGAAGAGGG - Intergenic
972713088 4:41618237-41618259 GGCAGTGTTTGTTGGAATGATGG + Intronic
972727755 4:41760482-41760504 GGCAGTGGAGGTTGGGACGAGGG - Intergenic
972961171 4:44453937-44453959 GAATGTTTATGTTGGGAAGGTGG + Intergenic
973129813 4:46636504-46636526 GAGTGTGTATGTTGGGGATAGGG - Intergenic
973232959 4:47863806-47863828 GGCAGTGTCTGTTGGAAAGTAGG - Intronic
973970203 4:56205562-56205584 GTGTGTGTGTGTTGGGGAGAAGG + Intronic
975337684 4:73199247-73199269 GTGTGTGTGTGTTGGGAGGAGGG + Intronic
977098615 4:92778127-92778149 GGATGAGCATGTTGAGAAGAGGG - Intronic
978010635 4:103678359-103678381 GGGTATGTAAGTTGTGAAGATGG + Intronic
978563779 4:110060726-110060748 GGCTGACCATGTGGGGAAGATGG + Intronic
979528188 4:121739715-121739737 GGCTGTTTGTGTTGGCAATAAGG + Intergenic
980177549 4:129365137-129365159 GGCTGAGTCTCTTTGGAAGAGGG - Intergenic
981222209 4:142250199-142250221 GAATGTGTATGTTGGGAATCTGG - Intronic
982469589 4:155772197-155772219 AGCTGTTTATGTTTGGAAAAAGG + Intronic
982623971 4:157741590-157741612 GGTGGTGAATGTTTGGAAGATGG - Intergenic
983804183 4:171973075-171973097 GTGTGTGTATGTTGGGGAGGAGG - Intronic
984117402 4:175698877-175698899 GGCAGTGTATGTAGGGGTGAGGG - Intronic
984417484 4:179479705-179479727 GGTTGTGTGTGTGGGGAAGCGGG - Intergenic
986018012 5:3774989-3775011 GGATGGGTGTGTTGGGTAGATGG - Intergenic
987052086 5:14155668-14155690 GGCTGTGCATTTTTGGCAGAAGG + Intronic
987093081 5:14524698-14524720 GGCCGTGCATGTCGGGGAGAGGG + Intronic
988001512 5:25355484-25355506 GTTTGTGTATGTTAGGAAGTGGG + Intergenic
989578423 5:43010201-43010223 GGCTGTTTATGCTGGGAAGATGG - Intergenic
990940152 5:61193987-61194009 GGCTGTGTGTGAGGAGAAGATGG + Intergenic
991630711 5:68654045-68654067 GGGGGTGTGTCTTGGGAAGATGG - Intergenic
993045277 5:82859323-82859345 GTGTGTGTATGTTGGGAGGGAGG - Intergenic
993951031 5:94175558-94175580 GGCTGTGTAGGTGAGAAAGAAGG - Intronic
995226043 5:109702351-109702373 GTCTGTGTGTGTAGGGAGGATGG + Intronic
995700927 5:114934238-114934260 GGTGGTGTGTGTCGGGAAGATGG + Intergenic
995881118 5:116845634-116845656 GGCAGAGTATGTTGGAAAGAAGG + Intergenic
996210819 5:120807455-120807477 GGTTGTGAATGTAGGGAATAGGG - Intergenic
997355627 5:133260948-133260970 GGCTGGAGATGTTGGGAGGAGGG + Intronic
997912857 5:137893553-137893575 GGATGGGTATTTTAGGAAGAAGG + Intronic
998893070 5:146767647-146767669 GGCTGTGCATGTGTGGAAGCAGG - Intronic
999733371 5:154493060-154493082 GGATGTGTATGTTGCCAAAATGG + Intergenic
999900106 5:156077839-156077861 GGCTGTGGAGGTTGGAAACAAGG + Intronic
1001068395 5:168559484-168559506 GGCTGTGTGTGTATGGAAGGTGG + Intronic
1001268158 5:170290219-170290241 TGCTGTGGGTGTTGAGAAGAGGG + Intronic
1002410542 5:179071554-179071576 ACCTGTGTATATTTGGAAGAAGG + Intronic
1004339869 6:14798747-14798769 GGCTGAGAATGTTGGGGAGGGGG - Intergenic
1007160477 6:39787829-39787851 AGCTGTGTGTGTTGGGTGGAGGG + Intergenic
1007994059 6:46287466-46287488 GTGTGTGTATTTTGGGAAGTGGG - Intronic
1009741401 6:67751436-67751458 TGTTGTGTATGGTGGGCAGAGGG + Intergenic
1012881574 6:104797386-104797408 GGATGTGTGTGGTAGGAAGAAGG - Intronic
1013609969 6:111785481-111785503 GTTTGTGTGTGTTGGGAAGCGGG - Intronic
1013783539 6:113754638-113754660 GGGTGTGTGGGTTGGGGAGAGGG + Intergenic
1017709080 6:157150031-157150053 GCCTGTGTAGGTTCGGCAGAGGG - Intronic
1022390787 7:29942797-29942819 GGCTGTGTCTGTCTGGAGGAGGG - Intronic
1024152742 7:46589236-46589258 GGTTGTTTTTCTTGGGAAGAGGG + Intergenic
1024296718 7:47849695-47849717 GGTTGTGTATGTGGTGAAAAGGG + Intronic
1024503369 7:50138190-50138212 GCCTATTTATGTTGGGAAAATGG - Intronic
1024553606 7:50584245-50584267 GGGTGTTTAGGTTGGCAAGAGGG + Intergenic
1024556516 7:50607824-50607846 GGGTGTGTAGGTTGGGATGCTGG - Intronic
1024568119 7:50700917-50700939 GTCTCTGTCTGTTGGGTAGAGGG + Intronic
1025803053 7:64805596-64805618 GGCTGTGTCTCAAGGGAAGATGG + Intronic
1026344500 7:69462507-69462529 GGCTGTGTAAGCAAGGAAGAAGG + Intergenic
1026582858 7:71632574-71632596 GTCTGTGTGTGTTGGGGACAAGG + Intronic
1029128834 7:98314578-98314600 AGCTGTGTGTGTTGGAAGGAGGG + Intronic
1029221853 7:98996124-98996146 AGGTGTGTATGATGGGATGAGGG - Intronic
1030556055 7:111025079-111025101 GGATGAGTATGGTGGGAGGAGGG - Intronic
1032100534 7:128972926-128972948 GGCTGTGTGTGTTAGGAGGGAGG + Intronic
1032505736 7:132433345-132433367 TGCTGGGTATGTAGGGTAGAAGG - Intronic
1034309986 7:150079029-150079051 CCCTGTGTATGTGGGGATGAAGG - Intergenic
1035293220 7:157853319-157853341 GGCCGTGCCTGTTGAGAAGAAGG - Intronic
1035399894 7:158557870-158557892 TGCTGGGAATGCTGGGAAGAGGG - Intronic
1035695563 8:1593100-1593122 GGCTGTGTTTGTTGAGGGGAAGG - Intronic
1036599955 8:10251674-10251696 GGATGTGGGTGTGGGGAAGATGG - Intronic
1038134730 8:24773004-24773026 GGCTGTGGATCTAGGGAAAATGG + Intergenic
1039088821 8:33806409-33806431 GGCAGTGTGTGCTGGGGAGATGG + Intergenic
1041724447 8:61004976-61004998 GGATGTGTATATCGGTAAGAAGG - Intergenic
1042872424 8:73410909-73410931 GGCTGTGTAGGTTGAGAGGATGG - Intergenic
1043184963 8:77137044-77137066 GTGTGTGTATGTTGGGATGTGGG + Intergenic
1046144288 8:110137355-110137377 GTGTGTATATGTTGGGATGAGGG + Intergenic
1047243017 8:123110646-123110668 GTGTGTGTATGTTGGGATGTGGG - Intronic
1047882586 8:129212692-129212714 GGATGTGTGTGTTGGGAAGAGGG + Intergenic
1048044752 8:130763057-130763079 GGCTGTGGATGTGGGGTTGAGGG + Intergenic
1048238051 8:132711829-132711851 GGGTGTGTGTGTTGGGGGGAGGG + Intronic
1049319680 8:141989446-141989468 AGCTGTCTGTGCTGGGAAGAGGG + Intergenic
1050078276 9:1888069-1888091 GGGTGTGAATGCTAGGAAGAAGG + Intergenic
1052141894 9:24996094-24996116 GTCTGTGTAGGATGGGAAGGGGG + Intergenic
1052263537 9:26545751-26545773 GAGGGTGTATGCTGGGAAGAGGG + Intergenic
1052276295 9:26680331-26680353 GGCTGTGACTGTTTGGTAGAAGG - Intergenic
1054894097 9:70287723-70287745 GGTTGTGTATGTTGGGAGAAGGG + Intronic
1055967585 9:81880658-81880680 GGGTGTGAGTGTTGGGGAGAGGG + Intergenic
1056787527 9:89603851-89603873 GGGTGTGTGTGTTGGGGGGAGGG + Intergenic
1056911713 9:90707025-90707047 GGCAGCCTGTGTTGGGAAGAAGG + Intergenic
1057849311 9:98552479-98552501 GGCTGTGTGTGTTGGGAACTCGG + Intronic
1058281038 9:103115240-103115262 GGCTCTGAAAGTTGGGAAGAAGG + Intergenic
1058758115 9:108102599-108102621 GTGTGTGTATGTTGGGGAGTAGG + Intergenic
1059541634 9:115136269-115136291 GTGTGTGTATGTTGGGGGGATGG + Intergenic
1059635155 9:116163164-116163186 GGCAGTGGGTGTTGGGGAGAAGG + Intronic
1059810180 9:117847921-117847943 GGTTCTGTATGTTGAAAAGAAGG - Intergenic
1061019920 9:128007790-128007812 GGCTGTTTCAGTGGGGAAGAAGG + Intergenic
1061580803 9:131534652-131534674 GGCTGTGCATGTGGGGGAGTGGG + Intergenic
1062059866 9:134489406-134489428 GGCTGTTGGTGTTGGGAAGCTGG + Intergenic
1185910214 X:3974081-3974103 GGCTGTTTTAGTTGGGAAAAAGG + Intergenic
1186310297 X:8310301-8310323 GTGTGTTTATGTGGGGAAGAAGG + Intergenic
1186356279 X:8794569-8794591 GTGGCTGTATGTTGGGAAGATGG - Intronic
1186619620 X:11224835-11224857 GGCTGTGTATGTTGGGAAGATGG + Intronic
1186795066 X:13039298-13039320 GTGGCTGTATGTTGGGAAGATGG - Intronic
1187170435 X:16846469-16846491 GTCTGTGTACGTTGGAAAGATGG - Intronic
1187464829 X:19517749-19517771 AGCTGGGGATGTTGGGAAGGAGG - Intergenic
1187642153 X:21304494-21304516 AACTGTGTATGTTGGGGAGGGGG + Intergenic
1187654849 X:21460070-21460092 GAGTATGTATGGTGGGAAGACGG - Intronic
1188862846 X:35277633-35277655 GGCTGTGAATGGTAGGAAAATGG - Intergenic
1190323723 X:49193682-49193704 GGCTGTGGGTGTTGGGGGGAGGG + Intronic
1192188792 X:68978263-68978285 GGCAGTGTCTGCAGGGAAGAGGG - Intergenic
1194184445 X:90756531-90756553 GGCTTTGCATGTTTGAAAGAAGG + Intergenic
1195064957 X:101232294-101232316 GCCTGTGTATGTTGGTAGGCAGG + Intronic
1195745862 X:108117383-108117405 GACTGTGGATGTTTAGAAGAAGG + Intronic
1196478711 X:116121077-116121099 GACTCTGCATGTTTGGAAGAAGG - Intergenic
1196872844 X:120128977-120128999 GGGAGTGTCTGTTGGAAAGAAGG + Intergenic
1197128864 X:122980402-122980424 GGCTGTGTATGGAGGAAAGGAGG - Intergenic
1197175009 X:123476364-123476386 GTGTGTGTGTGTTGGGGAGAGGG + Intronic
1197735399 X:129847057-129847079 GGCTGTGTGTGTGGGGAGGAGGG - Intergenic
1198618865 X:138485197-138485219 GGGAGTGTGTGTTGGGAAGGTGG - Intergenic
1198654149 X:138895280-138895302 GTATGTGTGTGTTGGGAGGAAGG + Intronic
1199375493 X:147103187-147103209 GAGGGTGGATGTTGGGAAGAGGG + Intergenic
1199888959 X:152055775-152055797 GACGGTGGATGTTGGGAGGAGGG - Intergenic
1200090663 X:153634382-153634404 GGCTGTGTCTGTAGGTAGGATGG - Intergenic
1200531034 Y:4338444-4338466 GGCTTTGCATGTTTGAAAGAAGG + Intergenic
1201951815 Y:19573619-19573641 GGAGGTGTATGTTAGGAAAACGG - Intergenic