ID: 1186625681

View in Genome Browser
Species Human (GRCh38)
Location X:11290805-11290827
Sequence GACACTTATTTTTGACTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186625681_1186625686 25 Left 1186625681 X:11290805-11290827 CCCAGCAGTCAAAAATAAGTGTC 0: 1
1: 0
2: 0
3: 19
4: 172
Right 1186625686 X:11290853-11290875 CTCACAGGCGAGGCCCTCCCAGG 0: 1
1: 0
2: 1
3: 17
4: 202
1186625681_1186625685 15 Left 1186625681 X:11290805-11290827 CCCAGCAGTCAAAAATAAGTGTC 0: 1
1: 0
2: 0
3: 19
4: 172
Right 1186625685 X:11290843-11290865 ATTTGCTTTTCTCACAGGCGAGG 0: 1
1: 0
2: 2
3: 16
4: 170
1186625681_1186625684 10 Left 1186625681 X:11290805-11290827 CCCAGCAGTCAAAAATAAGTGTC 0: 1
1: 0
2: 0
3: 19
4: 172
Right 1186625684 X:11290838-11290860 AATTCATTTGCTTTTCTCACAGG 0: 1
1: 0
2: 2
3: 40
4: 417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186625681 Original CRISPR GACACTTATTTTTGACTGCT GGG (reversed) Intronic
903474053 1:23607311-23607333 GACACACATTTTCCACTGCTGGG + Intronic
906006203 1:42473602-42473624 GACTCTTTTTTTTGAAGGCTTGG + Intronic
910320532 1:85938420-85938442 GTGACTTATTTTTGCCTGCTGGG - Intronic
911113221 1:94213902-94213924 GACATCTAATTTTGACTGATAGG - Intronic
913439045 1:118878017-118878039 TAGCCTTATCTTTGACTGCTGGG + Intergenic
914213806 1:145606570-145606592 GACAGGTAGTTTTGACTGCTTGG + Intergenic
914465750 1:147926975-147926997 GACAGGTAGTTTTGACTGCTTGG + Intergenic
916184463 1:162117343-162117365 GACACTTTAGTCTGACTGCTTGG + Intronic
920830102 1:209456806-209456828 TACACTTATTTTTAACTGTTGGG + Intergenic
921696688 1:218219213-218219235 GACTCTTTTGTTAGACTGCTAGG + Intergenic
921707399 1:218339682-218339704 GACAAATAATTTTGCCTGCTGGG - Intergenic
1063754098 10:8986009-8986031 GATACTTATTTATGAGTCCTGGG - Intergenic
1065201662 10:23318289-23318311 CACTCATATTTTTGACTCCTGGG + Exonic
1071489403 10:86125995-86126017 TACACAGATTTTTGACTGCATGG + Intronic
1074233234 10:111558651-111558673 GATACTTATTTTTAGCTGCTGGG + Intergenic
1075638125 10:124044288-124044310 GGCACTTACTGCTGACTGCTCGG + Intronic
1076225019 10:128767266-128767288 GACCCTCGTTTTTGACTGATGGG - Intergenic
1078705236 11:13737457-13737479 AACACTAATCTTTAACTGCTTGG - Intergenic
1078980547 11:16527819-16527841 GACATTTATTTTTCAGTGATGGG - Intronic
1081727321 11:45339691-45339713 GCCAGTTATTTTTGACGGCTTGG - Intergenic
1082016885 11:47495958-47495980 AACAAGTATTTTTGCCTGCTGGG - Intronic
1085887740 11:80540279-80540301 AATACTTTTTTTTTACTGCTGGG - Intergenic
1085976134 11:81658267-81658289 GAAACTTCTTTTTTTCTGCTTGG + Intergenic
1085994595 11:81895464-81895486 GACACTTATGACTGAGTGCTAGG - Intergenic
1088390368 11:109307516-109307538 GACCCTTATTCGTGACTGGTAGG + Intergenic
1093371308 12:18368580-18368602 GACAGATATTTTTAACTGATAGG - Intronic
1093898726 12:24605683-24605705 GACATTTATTTTTGGCTCATGGG - Intergenic
1095509312 12:42932766-42932788 GGCACAGATTGTTGACTGCTGGG + Intergenic
1095788438 12:46136984-46137006 AACAGTTTTTTTTAACTGCTTGG - Intergenic
1097794412 12:63846158-63846180 GACACAGATTTTTGTCTGCTTGG + Intronic
1098043285 12:66373946-66373968 AACTCTTTTTCTTGACTGCTTGG + Intronic
1098043289 12:66374032-66374054 CACACTTGTTTTTAAATGCTAGG - Intronic
1100606689 12:96157752-96157774 GACACTTTTTTTTGCCTTCAAGG + Intergenic
1100973545 12:100097380-100097402 GACTCTGATTTTTGATTGGTTGG + Exonic
1101094502 12:101322899-101322921 GATAGTTATTTTTGAGTGTTTGG - Intronic
1101979058 12:109389506-109389528 AGCTCTTATTTTTGCCTGCTTGG - Intronic
1102937988 12:116913354-116913376 TACACAGATTTTTGACTGCAAGG - Intronic
1103504148 12:121429846-121429868 GACACTTTTTTTTGTTTGGTTGG - Exonic
1106957831 13:34961925-34961947 CACACTTAATTTTGAGGGCTAGG + Intronic
1108073181 13:46651358-46651380 GAAACTCATTTTTGACTGCAAGG - Intronic
1111669776 13:91315619-91315641 GTCACTTATTTTTGTTAGCTTGG + Intergenic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1111773242 13:92625766-92625788 TACACTTAATTTTGACTTTTGGG - Intronic
1114056376 14:18971144-18971166 AACATTTATGTTTGCCTGCTGGG + Intronic
1114106174 14:19430583-19430605 AACATTTATGTTTGCCTGCTGGG - Intronic
1115253545 14:31374406-31374428 GACACAGATTTTTGACTTCGAGG + Intronic
1117633191 14:57714847-57714869 GACACTTATTTTGGACTTAACGG + Intronic
1118123300 14:62870278-62870300 GGTAATTTTTTTTGACTGCTTGG + Intronic
1119488914 14:75013376-75013398 GCCACTTTTTTTGGACTGCTCGG + Intergenic
1120642239 14:87029254-87029276 GTCTCTTACTTTTGTCTGCTGGG - Intergenic
1121647791 14:95532626-95532648 GATAATTATTTTTGACTACAAGG - Intergenic
1125264971 15:37868256-37868278 GACACTGACTTTTGTCTGCATGG - Intergenic
1126136096 15:45393321-45393343 GCCACTTAGTTTTGAATCCTAGG + Intronic
1127195775 15:56583933-56583955 ATCAATTATTTTTGACTGCAAGG - Intergenic
1127333403 15:57960463-57960485 ATCAATTAATTTTGACTGCTCGG - Intronic
1127954631 15:63842578-63842600 TACATTAATTTTTGACTGCAGGG - Intergenic
1129421342 15:75429450-75429472 TACATGTATTTTTGACTGCATGG + Intronic
1131396991 15:92094010-92094032 GACTCTTATTTTTGCCTCCAGGG + Intronic
1132191300 15:99864006-99864028 TACACTTAATTTTGACTTTTGGG + Intergenic
1133367561 16:5222569-5222591 GAAACATATTTATGAATGCTTGG + Intergenic
1134391736 16:13826170-13826192 GCCTCTTCTTTTTGACTTCTGGG - Intergenic
1135887545 16:26324801-26324823 GACACTTGTTTTTGTCTCCCTGG - Intergenic
1137790093 16:51167725-51167747 TACACTTAACTTTGGCTGCTTGG - Intergenic
1138857264 16:60709389-60709411 TACACAAATTTTTGACTGCATGG - Intergenic
1139134545 16:64186053-64186075 TACAATTATTTTTGTCTGCCAGG + Intergenic
1139954935 16:70688570-70688592 GACATTTGTTTTTGAGTGTTGGG + Intronic
1141025609 16:80544260-80544282 GACAATAATTGTTGAGTGCTTGG + Intronic
1141278640 16:82610259-82610281 GACCCATATTTTTGAGTGCCTGG - Intergenic
1141957403 16:87382322-87382344 GTGGTTTATTTTTGACTGCTGGG + Intronic
1142507291 17:372642-372664 GACATTTATTTCTGACGGTTTGG - Intronic
1144021779 17:11244405-11244427 GAAACTTATTTTTCAGTTCTGGG + Intronic
1144604447 17:16652736-16652758 GATACTTCTTCTTGTCTGCTTGG - Intronic
1146376743 17:32299632-32299654 GAATCTTATTTTTGTCTTCTAGG - Intronic
1146948117 17:36887910-36887932 GACACCTATTTGTGACTTCTAGG + Intergenic
1147111938 17:38269222-38269244 GACAGTTATCTAGGACTGCTAGG - Intergenic
1157660456 18:49437460-49437482 GACATTTATTTTTTATTACTTGG - Intronic
1162196857 19:8991670-8991692 GACACTGATATTGGACAGCTTGG - Intergenic
1162802946 19:13120930-13120952 GACAGTTTTATTTCACTGCTGGG + Intronic
1163024591 19:14503099-14503121 GACACCTGCCTTTGACTGCTGGG + Intergenic
928348956 2:30529113-30529135 GAAAATTATTTTTAACTGTTTGG - Intronic
928647192 2:33367029-33367051 GACACTCACTTTTGACAGTTGGG + Intronic
933051112 2:77603895-77603917 AACAATTATTTTTGCCTACTTGG - Intergenic
934473076 2:94573392-94573414 GACACATACTTCTGACTGCCTGG - Intergenic
936621627 2:114105247-114105269 GACAATTTCTATTGACTGCTTGG + Intergenic
936768946 2:115888375-115888397 GAGACTTATTTTTCCTTGCTTGG + Intergenic
937283374 2:120735613-120735635 GACACTTTTTTTAGACGACTAGG - Intronic
938663949 2:133514646-133514668 GACACATATTTTTGAGAGTTAGG - Intronic
942137846 2:172946295-172946317 CACAATTATCTTTGACTGGTTGG + Intronic
942263463 2:174195538-174195560 GGCATTTCTTTTTCACTGCTTGG - Intronic
945379424 2:209121867-209121889 GACACTCAGTATTAACTGCTTGG + Intergenic
946162642 2:217845523-217845545 GACACTTATATTTGGCTCCCAGG - Intronic
947291101 2:228574726-228574748 GGCACTTATTTTAGAGGGCTTGG + Intergenic
947344257 2:229174447-229174469 AACAATTAATTCTGACTGCTGGG + Intronic
1173967953 20:47128023-47128045 CACACCTGTTTTTGACTCCTAGG + Intronic
1175644855 20:60662535-60662557 GACACTGCTTCTTGACTGTTTGG + Intergenic
1178387767 21:32168294-32168316 GACATATGTTTTTGTCTGCTTGG - Intergenic
1178861849 21:36296419-36296441 GATACTTAATTTTTACTGCTGGG - Intergenic
1179391486 21:40996172-40996194 TACACAGATTTTTGACTGCGTGG - Intergenic
1179839828 21:44064692-44064714 GGAACTTATTTTTGTGTGCTTGG + Intronic
1180474862 22:15693755-15693777 AACATTTATGTTTGCCTGCTGGG + Intronic
1180592812 22:16955488-16955510 CACACTAATTTTTGGCTCCTGGG + Intergenic
1182904642 22:33924659-33924681 GACATTTATTCTTTAGTGCTGGG + Intergenic
1183612621 22:38920747-38920769 GAAAGTTAGTTTTGTCTGCTGGG + Intergenic
1183959569 22:41403240-41403262 GAGATTTATTTCTGACAGCTCGG - Intergenic
951403726 3:22268182-22268204 GACACTTATGTTGGACAGCTGGG - Intronic
952044346 3:29300052-29300074 GACATATATTTTTGAGTGCTTGG - Intronic
952074758 3:29682486-29682508 GATAATGATTTTTGGCTGCTTGG + Intronic
952091348 3:29890321-29890343 GACACTTATGTTAGGCTCCTTGG - Intronic
952295422 3:32057949-32057971 GACATTGATTTTTAACTGCATGG + Intronic
952311296 3:32192701-32192723 GACTCTTACTTCTGACTGTTGGG - Intergenic
952592397 3:34972642-34972664 GACACATAGCTCTGACTGCTGGG + Intergenic
957397633 3:79662964-79662986 GGTATTTATTATTGACTGCTAGG + Intronic
958409605 3:93800430-93800452 GATACTTATCTTTGAATGTTTGG - Intergenic
965481179 3:169221419-169221441 AACAATTATTTTTGGATGCTAGG - Intronic
967798791 3:193630697-193630719 GACAATTATTTTTAAAGGCTGGG + Intronic
970328377 4:14952972-14952994 GACAAGTAATTTTGACTGCATGG + Intergenic
971758217 4:30729700-30729722 GATAATTACTTTTGACTTCTGGG + Intronic
972668209 4:41188615-41188637 GACACTTATTTCTCACAGTTCGG - Intronic
973080473 4:45985340-45985362 GACACTTAATTTATACTCCTTGG + Intergenic
974592180 4:63966967-63966989 GAAAATTATTTTTCACTTCTAGG - Intergenic
978208289 4:106105329-106105351 GTCATTTTTTTTTGACTCCTGGG - Intronic
981018383 4:139999611-139999633 AACATTTATTTTTAAATGCTGGG + Intronic
981081028 4:140639586-140639608 GATATTTATTTCTGATTGCTCGG - Intronic
982717070 4:158820210-158820232 TAAACTTATTTTTGACTGTGTGG + Intronic
983332241 4:166345210-166345232 GGCAATTATTTTTAACTGCTAGG - Intergenic
983693063 4:170496009-170496031 GACACTTATTTTTAAGTTCTGGG - Intergenic
987491816 5:18590299-18590321 GTCACTTATTTTTGCCTCCAGGG - Intergenic
988411288 5:30889044-30889066 GACACTTGTATTAGTCTGCTAGG + Intergenic
989215497 5:38900669-38900691 GATAATTATTTTTGACTACAAGG + Intronic
990818949 5:59815942-59815964 GAAAGTTATTTTTGTATGCTTGG - Intronic
991296046 5:65082298-65082320 AATAGTTGTTTTTGACTGCTCGG - Intergenic
991513105 5:67402162-67402184 GACAGTTAATTTTTCCTGCTGGG + Intergenic
992609290 5:78493370-78493392 GACAGTTTCTTGTGACTGCTAGG - Intronic
995029834 5:107467688-107467710 GACTCTTATATTTTACTTCTAGG - Intronic
995409332 5:111836872-111836894 GACACTTCTTTCTGGGTGCTAGG + Intronic
996604926 5:125310422-125310444 GGCAGCTATTTTTGACTACTTGG - Intergenic
1000466502 5:161584623-161584645 GACAAATATTTTTGAATTCTGGG - Intronic
1002201910 5:177533631-177533653 GACACTTATTTTGGAGGACTTGG - Intronic
1003106212 6:3218243-3218265 GAGACTTATCTTTGAATGATCGG + Intergenic
1003911685 6:10749135-10749157 CACACTTCTTTCTGACTGCTGGG + Intronic
1004413314 6:15401450-15401472 AACATTTATTTTTAAATGCTGGG - Intronic
1005424658 6:25689750-25689772 GACTTTTTTTTTTGACTCCTTGG + Intronic
1008065413 6:47042505-47042527 GACACCCATTTATGTCTGCTGGG - Intergenic
1008815748 6:55563480-55563502 CACACTTATTTTTCACTCCTGGG + Intronic
1010094728 6:72028142-72028164 ACCAATTATTGTTGACTGCTTGG - Intronic
1013160858 6:107543372-107543394 GACTCTTTTTTTGGAATGCTAGG - Intronic
1014112518 6:117635347-117635369 GACACAGAGTTTTGACTGGTGGG + Intergenic
1015156783 6:130105491-130105513 GACCCTCATTTTTGGATGCTGGG - Intronic
1016011978 6:139146689-139146711 GGCACTTATTTTTCAATGCCAGG - Intronic
1016468871 6:144353886-144353908 GTCATTTATTTTTGGCTCCTTGG - Intronic
1016488995 6:144575308-144575330 AACAGTTATTTTTGGGTGCTGGG - Intronic
1023354056 7:39349654-39349676 GACATGGAGTTTTGACTGCTTGG - Intronic
1023515646 7:40998541-40998563 GATACTAATTTATGACTGCTGGG - Intergenic
1027611163 7:80362507-80362529 GATACTTCTGTTTAACTGCTTGG + Intergenic
1028195467 7:87902381-87902403 AACACATATTTTTGAGTACTGGG + Intronic
1029316378 7:99718386-99718408 GATAATTATTTTTGCCAGCTTGG + Intronic
1033043006 7:137935752-137935774 GGCACTTATTTATAACTGTTGGG - Intronic
1033190147 7:139270574-139270596 CACATTCATTTTTTACTGCTGGG + Intronic
1033924464 7:146441014-146441036 GACTCTTATTTTAGACTTGTAGG - Intronic
1035309643 7:157957302-157957324 GACACGTATTTTTGGCATCTAGG + Intronic
1037598816 8:20376427-20376449 GAGACTGATTTTTGACAGCGAGG + Intergenic
1038455662 8:27670765-27670787 GACACTCATTTCTCACTGCAAGG - Intronic
1043811602 8:84749549-84749571 GACACTTGTTCCTGACTTCTTGG - Intronic
1043850932 8:85215823-85215845 AACACTTATTTATAACTGGTTGG + Intronic
1043866254 8:85378986-85379008 ATCAATTATTTTTGACTGTTGGG + Exonic
1046465006 8:114589797-114589819 GTGAATTATTTTTGACTTCTGGG - Intergenic
1047078502 8:121432746-121432768 GACACTTATTTCTGACCTCAAGG + Intergenic
1051820262 9:21157538-21157560 GAGTCTTATTTTTGTTTGCTTGG - Intergenic
1056617697 9:88182703-88182725 GAAACACATTTTTCACTGCTCGG + Intergenic
1057516491 9:95726204-95726226 CACACTTTTTTTGGACTCCTGGG - Intergenic
1058325739 9:103695744-103695766 GACAGTTTTTTTTGTCTGGTTGG + Intergenic
1058774188 9:108267757-108267779 AACGCTTATTTTTAAATGCTAGG - Intergenic
1186121503 X:6367877-6367899 GACAGTTAATTTTGATTGCATGG - Intergenic
1186563310 X:10635822-10635844 AACACTTATTTTTGACAGGCTGG + Intronic
1186625681 X:11290805-11290827 GACACTTATTTTTGACTGCTGGG - Intronic
1186645410 X:11501558-11501580 TACACAGATTTTTGACTGCATGG - Intronic
1187380331 X:18795870-18795892 GCTTCTCATTTTTGACTGCTAGG + Intronic
1188908054 X:35811883-35811905 GACACTTCTTTTGGTCTGCTTGG - Intergenic
1189843819 X:45112759-45112781 GAGACTTATTTTTTAATGTTAGG + Intergenic
1193148520 X:78102070-78102092 GGCACTTATTATTAGCTGCTGGG - Intronic
1193366555 X:80640837-80640859 GTTACTTATTTTTTTCTGCTAGG - Intergenic
1193511683 X:82410031-82410053 GACACCTTATTTTGTCTGCTTGG + Intergenic
1195612606 X:106885588-106885610 AACTCTTATTTATGACTGATTGG - Intronic
1198999344 X:142615771-142615793 TAAACTGATTTTTGTCTGCTGGG - Intergenic
1200891762 Y:8331657-8331679 GACAGTCATTACTGACTGCTGGG - Intergenic
1201791416 Y:17845343-17845365 GGCAGTTATTTTAGAATGCTTGG - Intergenic
1201810138 Y:18060646-18060668 GGCAGTTATTTTAGAATGCTTGG + Intergenic
1202265337 Y:23012218-23012240 GACAGTTATTTCTGTCAGCTGGG - Intergenic
1202353028 Y:24014989-24015011 GGCAGTTATTTTAGAATGCTTGG - Intergenic
1202418330 Y:24645960-24645982 GACAGTTATTTCTGTCAGCTGGG - Intergenic
1202452456 Y:25024126-25024148 GACAGTTATTTCTGTCAGCTGGG + Intergenic
1202517751 Y:25655126-25655148 GGCAGTTATTTTAGAATGCTTGG + Intergenic