ID: 1186629949

View in Genome Browser
Species Human (GRCh38)
Location X:11338020-11338042
Sequence GACACTAGATTGGTTCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186629949_1186629956 30 Left 1186629949 X:11338020-11338042 CCCCTGAGAACCAATCTAGTGTC 0: 1
1: 0
2: 1
3: 10
4: 103
Right 1186629956 X:11338073-11338095 ACAGCACCAAGCCATTTATGAGG 0: 11
1: 154
2: 367
3: 850
4: 1283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186629949 Original CRISPR GACACTAGATTGGTTCTCAG GGG (reversed) Intronic
905129201 1:35740295-35740317 GACACCAGATTTATTCTCCGGGG - Intronic
913044495 1:115062257-115062279 GGCACTCGGTTGGCTCTCAGTGG - Intronic
913074513 1:115330545-115330567 GAAATTAGATTGCTTTTCAGAGG + Intronic
913442628 1:118914924-118914946 GTCACCAGCTTGGTCCTCAGGGG + Intronic
915754686 1:158248576-158248598 CACACTAGTTTGCTTCTCTGGGG + Intergenic
916522403 1:165575974-165575996 GACACTTGTTTTTTTCTCAGAGG - Intergenic
919026090 1:192172290-192172312 AAGACTGGATTAGTTCTCAGGGG + Intronic
920570255 1:207010995-207011017 GATACTGGAGTGGTTCTCACAGG + Intronic
922222138 1:223616723-223616745 GACAGCAGATTAGTTCTCAGGGG - Intronic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1067246508 10:44551371-44551393 GAGACAGGATTTGTTCTCAGGGG - Intergenic
1068405397 10:56582041-56582063 GTCACTAGCTTTGTTCTTAGTGG - Intergenic
1071833611 10:89396523-89396545 GAGACTGGATTGGTTCTTGGGGG - Intronic
1078324441 11:10368383-10368405 GACATTAAATTCATTCTCAGGGG - Intronic
1078700475 11:13676535-13676557 GACAAAGGATTGATTCTCAGTGG + Intronic
1079400511 11:20103076-20103098 GGCACTGGCTTGGTCCTCAGGGG - Intronic
1080612539 11:33916999-33917021 GACACTAGACTGATGATCAGTGG - Intergenic
1086483606 11:87272408-87272430 GAGACTAGAAAGGTTCACAGAGG - Intronic
1086603621 11:88666442-88666464 GAGACTCGATTGATTCTCATGGG - Intronic
1087137036 11:94731394-94731416 GATACTAAGGTGGTTCTCAGAGG + Intronic
1087801484 11:102509362-102509384 GAGACTGGATTGGTTCACAGGGG + Intergenic
1088574121 11:111253160-111253182 GACATTTGAATGGTTGTCAGAGG - Intergenic
1090169042 11:124582122-124582144 GAGACTGGATTAGTTCTCAAAGG + Intergenic
1095544247 12:43345930-43345952 GACAGTAAATTGGTACTGAGTGG - Intergenic
1096490600 12:52010670-52010692 GAGGCTGGATTGGTTCTCTGTGG + Intronic
1099822018 12:87724116-87724138 GACACTATCTTAGTTTTCAGAGG + Intergenic
1106734055 13:32571369-32571391 AAGACTAGATTGGTTCTCTGGGG - Intergenic
1106830446 13:33575613-33575635 GAGACTGGATTAGTTCTTAGGGG + Intergenic
1106920451 13:34557415-34557437 GACAGAAGATTGGGTTTCAGAGG + Intergenic
1108259023 13:48638632-48638654 GAGACTGGATTGGGTCTTAGGGG - Intergenic
1108452888 13:50585111-50585133 GACACCAGCTTTGTTCTCCGAGG - Intronic
1112307605 13:98289365-98289387 GACACCAGATTTGCACTCAGCGG - Intronic
1114586973 14:23824401-23824423 GATATTAGATTGAATCTCAGTGG - Intergenic
1117004010 14:51400293-51400315 GAGAGTAGAATGGTTCCCAGAGG - Intergenic
1126497184 15:49304729-49304751 GAAAGTAAATTGGTTCTCATTGG - Intronic
1136463048 16:30423943-30423965 AACACGAGAATGGGTCTCAGAGG + Exonic
1137737437 16:50735437-50735459 GTCACTAGATGGGTTTGCAGAGG + Intergenic
1143356512 17:6333084-6333106 CACCCAAGACTGGTTCTCAGAGG + Intergenic
1144324956 17:14169942-14169964 GAGACTGGATTAGTTCTCATGGG + Intronic
1148264528 17:46214730-46214752 GACACTAGCTGGGTTCAAAGTGG + Intronic
1150179264 17:63098312-63098334 GAAACTTGACTGGTTCTCACAGG - Intronic
1153612192 18:6897729-6897751 GAGACTAGATTAGTTGCCAGAGG + Intronic
1158772667 18:60539705-60539727 AGCACTAAATTGGTTTTCAGAGG + Intergenic
1158969818 18:62656094-62656116 GAGACTGAATTGGTTCTCAGCGG - Intergenic
1159078807 18:63712102-63712124 CACACTAATTTGCTTCTCAGTGG - Intronic
1160292626 18:77608482-77608504 GACAATAGGTTGGTGTTCAGCGG - Intergenic
1165706814 19:37982289-37982311 GACACTCCATTGGCTCCCAGAGG + Intronic
927168960 2:20352107-20352129 GAGACAAGGATGGTTCTCAGAGG - Intronic
928322541 2:30295155-30295177 GACACCAGATTGGTCCCCTGGGG - Intronic
933103935 2:78297340-78297362 GAGACTAGATTAGTTCTCACTGG + Intergenic
934771017 2:96907614-96907636 GACACTGGATTAGCACTCAGAGG + Intronic
938001827 2:127747842-127747864 AACATCAGATTAGTTCTCAGAGG - Intronic
938236837 2:129712193-129712215 GGCCCTAGAGTGGTTCTCGGAGG + Intergenic
939885369 2:147675722-147675744 GAGACTAGATTGGTTCTTGTGGG - Intergenic
939967561 2:148625391-148625413 GACATTAGATTTATTCTGAGGGG + Intergenic
940542498 2:155039264-155039286 GAAAGTAGATTGGTTCCCAGAGG + Intergenic
942721146 2:178953881-178953903 GACACAAGATTGGTGCCCAGAGG + Intronic
945037184 2:205714521-205714543 GACGCTTCATTTGTTCTCAGGGG - Intronic
947698649 2:232214439-232214461 GACACTAGATTTGTTCTATAGGG - Intronic
1170882990 20:20313944-20313966 GAAACTGAATTGGTTCTCACGGG - Intronic
1177289324 21:19090715-19090737 GAGACTAGATTTATTCTCACAGG + Intergenic
1179928263 21:44550367-44550389 GACGCTTTATTGGTGCTCAGAGG + Exonic
1179939420 21:44628346-44628368 GACGCTTTATTGGTGCTCAGGGG - Intronic
1180880723 22:19201839-19201861 GACACAAGATTGGTTGTGAACGG - Intronic
1181897492 22:26123376-26123398 GAGACTAGATTAGTTCTCTTGGG + Intergenic
949321906 3:2820612-2820634 GCCCCTTGATTGGTTGTCAGAGG - Intronic
950118573 3:10467111-10467133 GACACTGGATTGGAGCCCAGGGG + Intronic
952549123 3:34456045-34456067 GACAGTAGAATGGTTACCAGAGG - Intergenic
952868892 3:37879641-37879663 GACACTTGAGGGGATCTCAGAGG - Intronic
955316235 3:57941472-57941494 GAAACTGGATTAGTTCTCACAGG - Intergenic
959058990 3:101598779-101598801 GAGAGTAGATTGATTATCAGAGG - Intergenic
959259220 3:104053296-104053318 GACATTACATTGGAACTCAGTGG + Intergenic
960660237 3:120050166-120050188 GGTACTAGATTAGTTCTCATGGG - Intronic
961028141 3:123579080-123579102 GTCACTTAATTGGTTCTTAGTGG + Intronic
963274543 3:143317133-143317155 GACATTAGATTGGTTCTTTGAGG - Intronic
964667806 3:159192968-159192990 GAAACTAGAATGGATCTTAGAGG - Intronic
969658212 4:8510141-8510163 GACACGTGATCGGTTCTCACTGG + Intergenic
972982712 4:44725721-44725743 GACAATAGTTTGGATCTCTGAGG - Intronic
977161858 4:93644753-93644775 GAAAATAGACTGGGTCTCAGAGG + Intronic
978014762 4:103729328-103729350 GAAACTGGATTAGTTCTCATAGG - Intergenic
981488092 4:145308913-145308935 GAGACTAGATTAGTTCTCACAGG - Intergenic
984563943 4:181305190-181305212 GAAACTAGGTTAGTTCTCAAGGG + Intergenic
988918479 5:35919811-35919833 GACTGTAGACTGGTTCCCAGTGG + Intronic
994859025 5:105163872-105163894 GAGCTTGGATTGGTTCTCAGGGG - Intergenic
1000251396 5:159498971-159498993 GACAGTAGATTGGTTAAGAGTGG + Intergenic
1000805693 5:165788669-165788691 GAGAGTAGAATGGTTATCAGAGG - Intergenic
1004842715 6:19605739-19605761 GAAACTAGATTAGTTCTCCTGGG - Intergenic
1009309180 6:62127690-62127712 GACAGTAGATTTGTTCTGTGTGG - Intronic
1011150779 6:84270897-84270919 GACACTAAATTGGCTCACAATGG + Intergenic
1012062728 6:94509338-94509360 GAAAATAGATTTGTTGTCAGGGG + Intergenic
1012815563 6:104018374-104018396 GACCCTTGATGGGTTCTGAGTGG + Intergenic
1013155340 6:107488185-107488207 GTACCTAGATAGGTTCTCAGAGG + Intergenic
1014462610 6:121715437-121715459 AACACTACAGTGGTTCTCTGGGG + Intergenic
1015241389 6:131027464-131027486 CACAACAGATTGGGTCTCAGCGG + Intronic
1015877082 6:137833740-137833762 GAGACTGGATTGGTTCTGCGGGG - Intergenic
1027467378 7:78532871-78532893 GTCATTAGATTGGTTTTCATAGG - Intronic
1029327859 7:99825072-99825094 GACACTGGGTAGGTTCTCCGGGG + Intergenic
1037476122 8:19259483-19259505 GACAATCGTATGGTTCTCAGTGG - Intergenic
1040626717 8:49158102-49158124 GAGACTGGGTTGGTTCTCAAGGG - Intergenic
1041386147 8:57305460-57305482 GACAATAGAATGGTTGACAGAGG + Intergenic
1050927341 9:11281061-11281083 GAGACTAGATTGCGTGTCAGGGG + Intergenic
1051766959 9:20535168-20535190 GGCATTAGATTGTTTCTCATAGG + Intronic
1051889353 9:21926768-21926790 GACACTAGATTTTCTCACAGAGG + Intronic
1056045491 9:82711366-82711388 GAAAAGAGATTGGTCCTCAGTGG - Intergenic
1056374106 9:85990228-85990250 GAGACTGGATTAGTTCTCACAGG - Intronic
1056497520 9:87173863-87173885 GAGACTAGATTAGATCTCATGGG - Intergenic
1058532135 9:105916552-105916574 GAGACTGGATTGGCTCTTAGGGG - Intergenic
1061135298 9:128730181-128730203 GACACTGCATTGCTTCTCATCGG - Exonic
1185660145 X:1721062-1721084 GACACTTTATTGCTTCTCAGTGG - Intergenic
1186557300 X:10573426-10573448 GAGACTAGATTGGTTCTCACAGG - Intronic
1186629949 X:11338020-11338042 GACACTAGATTGGTTCTCAGGGG - Intronic
1186656370 X:11616102-11616124 GACAGCAGATTAGTTCTCAAGGG + Intronic
1190282466 X:48940060-48940082 CTCAGGAGATTGGTTCTCAGTGG - Intronic
1193203697 X:78722676-78722698 AACACCAGATTTGTCCTCAGAGG - Intergenic
1196414048 X:115452206-115452228 GACACTGGTTTGCTTCTCAAAGG + Intergenic