ID: 1186630521

View in Genome Browser
Species Human (GRCh38)
Location X:11343922-11343944
Sequence TGTCATAACCATACTGGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186630521_1186630524 -10 Left 1186630521 X:11343922-11343944 CCTATCCCAGTATGGTTATGACA 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1186630524 X:11343935-11343957 GGTTATGACACAAGATCACTTGG 0: 1
1: 0
2: 1
3: 9
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186630521 Original CRISPR TGTCATAACCATACTGGGAT AGG (reversed) Intronic
902961272 1:19964405-19964427 TGTCATCACCATCATGGGAACGG + Intergenic
910883058 1:91939782-91939804 TATTATAAACATACTGGGCTGGG - Intergenic
912504386 1:110146087-110146109 AGTCATAACCATAAAGGGTTTGG - Intergenic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
915860695 1:159441137-159441159 TGTCATAAACATACTCCAATAGG - Intergenic
916576613 1:166072589-166072611 TGAAATAACCATACTGGAGTCGG + Intronic
916728172 1:167542539-167542561 TGTCAGAATCATACTTGGAGAGG - Intronic
918380754 1:183952876-183952898 AGTCAGAATCATACTGTGATGGG + Intronic
919579982 1:199359311-199359333 TGTCATAAGCATGCAGTGATTGG - Intergenic
920363267 1:205433984-205434006 TGTCATAACTCCACTTGGATGGG - Intronic
921901176 1:220452722-220452744 TGTGATAGGCATACTGGGCTGGG - Intergenic
1065554793 10:26905102-26905124 TGTGATGACCATATTGGTATTGG - Intergenic
1065595830 10:27310070-27310092 TGTGATAACCATATTGGTATTGG + Intergenic
1066577710 10:36844498-36844520 TGTGATGACCATATTGGTATTGG + Intergenic
1068108370 10:52648424-52648446 TGTAATCATCATACTGGGTTTGG + Intergenic
1072729920 10:97838983-97839005 TGACATAACTATATTGGGAGGGG + Intergenic
1078595228 11:12680706-12680728 TTTCAAATCCCTACTGGGATAGG + Intronic
1081485538 11:43525077-43525099 TGTCCTAACCATGCTTGGGTAGG + Intergenic
1083919438 11:65774085-65774107 TGTCTAAACCATAAAGGGATGGG + Intergenic
1092461510 12:8690955-8690977 TGTTCTAACCCTACTGGGTTTGG - Intronic
1093360528 12:18221192-18221214 TATGATAACCAGACTTGGATAGG - Intronic
1099132176 12:78847830-78847852 TGTCATAACCATATTTTGTTAGG + Intergenic
1108024883 13:46167424-46167446 TGTCACACCCTTAATGGGATTGG - Intronic
1116337287 14:43673146-43673168 TGTCATAGCCATTCAGAGATAGG + Intergenic
1117037538 14:51743879-51743901 CGTCATATCCATGGTGGGATTGG + Intergenic
1117837872 14:59826476-59826498 TCACATAACCAGACTGGGACTGG - Intronic
1118042554 14:61932914-61932936 TGTCACAACTATACTGGACTGGG - Intergenic
1120057795 14:79946028-79946050 TGTCATATCCTCTCTGGGATGGG - Intergenic
1122430702 14:101639375-101639397 TGTCATCAGAATACTGGGCTCGG + Intergenic
1125430775 15:39591214-39591236 TGTCATAGTCATACTGAGCTGGG - Exonic
1125445925 15:39756273-39756295 TGTTATAAGCCAACTGGGATGGG + Intronic
1126479132 15:49098485-49098507 AGTTATAACCATACTTGTATTGG + Intergenic
1126726187 15:51634872-51634894 TGTCATCACCATATTGGTTTTGG + Intergenic
1131982360 15:98006421-98006443 TTTCATACTCATGCTGGGATTGG - Intergenic
1134249748 16:12566005-12566027 TGTCACCACCATGCTGGGCTGGG - Intronic
1139208136 16:65049276-65049298 AGTCTTAACCAAGCTGGGATGGG - Intronic
1141384464 16:83606759-83606781 TGTCATTACCAAACTGGCCTGGG - Intronic
1141513455 16:84527214-84527236 TGTCATCTCCACAGTGGGATTGG - Intronic
1147797142 17:43052512-43052534 TCTCATAAACACACTGGCATAGG + Intronic
1148732699 17:49847148-49847170 TGTCCTTACCATCCTGGGAATGG + Intronic
1151975581 17:77482054-77482076 TGTCACACCCATCCTTGGATGGG - Intronic
1152371993 17:79894449-79894471 TCTCATTATCATTCTGGGATTGG + Intergenic
1162364303 19:10238523-10238545 TGTCATGAGCATGCTGGGGTGGG - Intergenic
927353475 2:22146110-22146132 TGTGATAACCATACTAGCACAGG + Intergenic
928497154 2:31845034-31845056 TGTCATAAGAACACTGGTATTGG - Intergenic
934957750 2:98637867-98637889 TATCGTAACCATACTGTGACTGG - Intronic
940169753 2:150815711-150815733 TGTCTTCACCTTCCTGGGATAGG + Intergenic
1169509807 20:6251343-6251365 TGTCAATCCCATACTGAGATCGG + Intergenic
1177811195 21:25926431-25926453 TGCCAAAGCCATACTGTGATGGG + Intronic
1178412772 21:32379213-32379235 TGTCTTAATGATACTGGGAGGGG - Intronic
949387144 3:3515572-3515594 TGTCATTACCTGACTGGAATTGG - Intergenic
953144947 3:40266557-40266579 TCTCATGCCCATCCTGGGATTGG + Intergenic
958539146 3:95447609-95447631 TGTCATAACAGAACTGGCATGGG + Intergenic
963141356 3:141948582-141948604 TGCCATAACCACACTGAGAGAGG - Intergenic
965001179 3:162955936-162955958 TGTCATAATTATACTAGGATGGG + Intergenic
966121263 3:176523451-176523473 TTTCATATCCATGCTGGTATTGG - Intergenic
966685876 3:182694343-182694365 TGTCCTAGCAATACTGAGATAGG - Intergenic
967061173 3:185874057-185874079 TGTCATTAAAATACTGAGATAGG - Intergenic
969681455 4:8645572-8645594 TGCCTTCACCGTACTGGGATGGG + Intergenic
971313424 4:25546609-25546631 TGTCTTAAACATGCTGGGCTGGG + Intergenic
971548866 4:27923397-27923419 TCAAATAACCATACTGAGATTGG + Intergenic
972098789 4:35384347-35384369 TGCCATGATCATACTGGGAATGG + Intergenic
972752524 4:42006259-42006281 AGGGATAACCATACTGTGATAGG + Intronic
974682830 4:65185530-65185552 TGTCTAAACCATAATGGTATAGG + Intergenic
975335599 4:73171343-73171365 AATCATAGCGATACTGGGATTGG + Intronic
975835572 4:78419397-78419419 TGTCATAACCTTACTAGGGCAGG - Intronic
977482085 4:97592175-97592197 TTTAATTACCATACTGGGACTGG + Intronic
984400072 4:179252004-179252026 TGTCATAAACTTCCTGGGCTGGG - Intergenic
989636833 5:43544997-43545019 AATCATAACCATACTGTGATAGG - Intronic
995598890 5:113775228-113775250 GGTCAGAAACATACTGGGTTGGG + Intergenic
997680994 5:135750601-135750623 TGGCATACCTATACAGGGATGGG + Intergenic
998816598 5:146020866-146020888 TGTCATTATCATCCTGGCATAGG - Intronic
999410357 5:151344935-151344957 GGGCATAACCATTCAGGGATTGG + Intronic
1002923316 6:1589288-1589310 AGTCATTACAAGACTGGGATTGG + Intergenic
1016848732 6:148594926-148594948 ACTCAGAACCATACTGGGAAGGG - Intergenic
1021503413 7:21354560-21354582 TGTCATAACCTGAATGGGTTTGG - Intergenic
1031386576 7:121159072-121159094 TATCTAAACCATACTGGTATTGG + Intronic
1032496150 7:132364217-132364239 TGTCATAACCAAAATGTGAATGG - Intronic
1037414043 8:18629681-18629703 TGTCATAACCGTCATAGGATGGG + Intronic
1043351425 8:79365404-79365426 TCTCATAACAATACTGTGGTAGG - Intergenic
1043615825 8:82124285-82124307 TATCATGTCCATACTGGCATTGG + Intergenic
1046109839 8:109709349-109709371 GTTCATGACCGTACTGGGATTGG - Intergenic
1046398226 8:113669662-113669684 TGTCATATCCATTCTGCTATTGG + Intergenic
1047552538 8:125891098-125891120 TGTGATAAACATACTAGCATAGG + Intergenic
1048276613 8:133070876-133070898 TGTCATAAAATCACTGGGATGGG + Intronic
1051751082 9:20341451-20341473 TCTAATGACCATACTTGGATTGG - Intergenic
1060053977 9:120397587-120397609 TGTCATAATGATACTGTGTTGGG - Intronic
1062188099 9:135229316-135229338 TGTCATATCCAAAGTGGCATTGG - Intergenic
1186630521 X:11343922-11343944 TGTCATAACCATACTGGGATAGG - Intronic
1198004112 X:132474478-132474500 TGTCATAAAAGAACTGGGATAGG - Intronic
1200740624 Y:6850028-6850050 TGTCATAGCAATGCTGGCATGGG + Intergenic