ID: 1186636917

View in Genome Browser
Species Human (GRCh38)
Location X:11416139-11416161
Sequence GCGGCAGCACAGAAATATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 75}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186636910_1186636917 -10 Left 1186636910 X:11416126-11416148 CCCTCCCCCACCTGCGGCAGCAC 0: 1
1: 0
2: 3
3: 46
4: 368
Right 1186636917 X:11416139-11416161 GCGGCAGCACAGAAATATCATGG 0: 1
1: 0
2: 1
3: 2
4: 75
1186636907_1186636917 21 Left 1186636907 X:11416095-11416117 CCTTTCTAATGACGCCTTAAATA 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1186636917 X:11416139-11416161 GCGGCAGCACAGAAATATCATGG 0: 1
1: 0
2: 1
3: 2
4: 75
1186636908_1186636917 7 Left 1186636908 X:11416109-11416131 CCTTAAATAAAAATGTGCCCTCC 0: 1
1: 0
2: 0
3: 18
4: 198
Right 1186636917 X:11416139-11416161 GCGGCAGCACAGAAATATCATGG 0: 1
1: 0
2: 1
3: 2
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186636917 Original CRISPR GCGGCAGCACAGAAATATCA TGG Intronic
900884209 1:5403910-5403932 GCAGCAGCTCAGACACATCAGGG + Intergenic
903477189 1:23627690-23627712 GGGGGAGCAAAGAAATATGACGG - Intronic
907477790 1:54717632-54717654 GCAGCAGCACAGTACTATCTGGG + Exonic
911337176 1:96595113-96595135 GCGACAGCACAGCAGTGTCAGGG + Intergenic
914846758 1:151287745-151287767 GGGGCGGCACAGTGATATCACGG + Exonic
916519438 1:165550638-165550660 TTGACAGCAAAGAAATATCATGG - Intronic
918204717 1:182298705-182298727 TGGGCAGCACAGAAATATACAGG - Intergenic
918888897 1:190237672-190237694 TTCGCAGCACACAAATATCATGG + Intronic
1066018464 10:31272051-31272073 GTGGCAGAACAGAAAGACCATGG + Intergenic
1071098201 10:82003791-82003813 AGGGCAGCAGAGAAATAGCATGG + Intronic
1072460922 10:95617798-95617820 GTGGTAGCAAAGAAATTTCACGG + Intronic
1075105722 10:119538808-119538830 GCTGCAGCAAAGAACTATCTGGG + Intronic
1084913206 11:72408059-72408081 GAGGCAGCACCGAAATATAAAGG + Intronic
1089153256 11:116381151-116381173 CCAGCAGCACAGAGATAACAGGG + Intergenic
1092759160 12:11793690-11793712 GAGGCAGGAAAGAAAGATCAAGG + Intronic
1100692971 12:97058555-97058577 ACTGCAGCTTAGAAATATCAAGG + Intergenic
1102785335 12:115599799-115599821 GAGGCAACTCAGAAGTATCAAGG - Intergenic
1103320665 12:120091055-120091077 GGGGCAGCACAGCAATGGCAGGG - Intronic
1104280495 12:127372231-127372253 GCGGCAGGACAGAGAGAGCAGGG - Intergenic
1111655172 13:91142764-91142786 ACGGAAGCACAGAAACATGAGGG - Intergenic
1114402479 14:22422627-22422649 TCAGCAGCAAAGAAACATCAAGG + Intergenic
1115197184 14:30813677-30813699 TAGGCAGCAAAGAAATACCAAGG + Intergenic
1116179925 14:41519789-41519811 GCGGCTGCACAGAGACATGATGG - Intergenic
1122737002 14:103848541-103848563 GCGGCAGCACCGAACTCCCACGG + Intergenic
1131089952 15:89616469-89616491 GCTGCTGCACAGACAAATCAAGG + Exonic
1132298243 15:100760340-100760362 GCCTCAGCCCAGAAACATCATGG + Intergenic
1133434887 16:5770566-5770588 GCTGCTCCACAGAAATAGCAGGG - Intergenic
1134074031 16:11278054-11278076 GAGGCAGCATAGAAACACCAAGG - Intronic
1138299065 16:55911213-55911235 GCGGGAGCACAGATATACCTGGG - Intronic
1140763187 16:78130480-78130502 GCTGCAGCAACAAAATATCATGG - Intronic
1144444691 17:15316122-15316144 GCCTCAGCACAGAAGTAGCAAGG - Intronic
928081089 2:28313024-28313046 GGAGCAGCACAGAATCATCAAGG + Intronic
937244671 2:120485032-120485054 GGGGCATCACAGAAAGAGCAAGG - Intergenic
938654696 2:133419108-133419130 GCAGCAGCACAGAAGCATTAGGG - Intronic
939675211 2:145063628-145063650 GCAGTAGCACAGAAAAATGATGG + Intergenic
942677866 2:178447461-178447483 TCAGCAGCTCAAAAATATCATGG - Intronic
948281247 2:236749460-236749482 AAAGCAGCTCAGAAATATCAGGG - Intergenic
1172532898 20:35645884-35645906 GTGGGATCACAGAAAAATCAAGG + Intronic
1180935029 22:19619814-19619836 GGGGAAGCACAGAAAAATCTTGG - Intergenic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1182697863 22:32208511-32208533 GCTGCAGCACAGAGAGACCAGGG - Intergenic
1184803170 22:46774740-46774762 TCGGGGGCCCAGAAATATCAGGG - Intronic
1185168421 22:49276641-49276663 GCAGCAGCACATATATATCCTGG - Intergenic
961783637 3:129336453-129336475 GCGGCAGCACAGAGGAAGCAGGG - Intergenic
962500209 3:135983614-135983636 GTGGAAGAACACAAATATCAGGG - Intronic
964529372 3:157650737-157650759 GCAGCAGCATAAAAATATCTTGG - Intronic
965425132 3:168513664-168513686 CCAACAGCACAGAAATATCCAGG - Intergenic
968475307 4:803362-803384 GCGACAGCACCGAATTCTCACGG + Intronic
970439869 4:16071447-16071469 GCTTCAACACAGAAATGTCAGGG - Intronic
971454675 4:26833233-26833255 ACGGCACAACAGAAAAATCAAGG + Intergenic
972189864 4:36577022-36577044 ACAGCAGCACAAAGATATCAGGG - Intergenic
972924432 4:43985669-43985691 GAAGCAACACAGAAATATCCTGG + Intergenic
974164582 4:58185184-58185206 GCGAAAGAAAAGAAATATCAGGG + Intergenic
982438623 4:155406940-155406962 AAGGCAGCATAGCAATATCAGGG + Intergenic
982547854 4:156758217-156758239 GGGCCAGCACAGAAATTTGAGGG + Intergenic
983239939 4:165221041-165221063 TAGGCAGCACAGAAAGATTAAGG - Intronic
986378260 5:7156001-7156023 GCAGGAGCAAAGAAATAACAAGG - Intergenic
991188827 5:63844256-63844278 TAGGCTGCACAGAATTATCAAGG + Intergenic
995039670 5:107573245-107573267 GCGTGAGCAGAGAAATATAATGG + Intronic
999959612 5:156740524-156740546 GTGGCAACACAGAAGTATAATGG + Intronic
1002442213 5:179270355-179270377 CCGGCAGAACATAAATAGCAGGG + Intronic
1003260543 6:4511893-4511915 GCTGCAGCACAGTGACATCATGG - Intergenic
1004522433 6:16374751-16374773 GCCCCAGCACATAAATATTAGGG + Intronic
1008298164 6:49803678-49803700 TCAGCAGCACAGAAATCTCATGG - Intergenic
1010361293 6:74997518-74997540 GAGGCATCACAGAGATACCAAGG + Intergenic
1023551667 7:41376478-41376500 TCAGCAACACAGAAATATAAGGG - Intergenic
1025030606 7:55553722-55553744 AAGGGAGCACAGAGATATCAGGG - Intronic
1031039851 7:116827804-116827826 GTGGCAGCACAGAAAAATCAGGG - Intronic
1036764795 8:11542655-11542677 GTGGCCTCACAGTAATATCAGGG - Intronic
1039180655 8:34862272-34862294 CCTGAAGCTCAGAAATATCAGGG - Intergenic
1043520508 8:81040255-81040277 GAGACTGAACAGAAATATCATGG - Intronic
1045358433 8:101410532-101410554 GAGACAGCACAGAAATTTAAGGG + Intergenic
1045651444 8:104345173-104345195 GTGGCAGCAAAGAAACAACAAGG + Intronic
1047964377 8:130034882-130034904 GCTGCAAAACAAAAATATCAAGG - Intergenic
1055753102 9:79528711-79528733 CCCACAGCACAGAAATATGAGGG + Intergenic
1186636917 X:11416139-11416161 GCGGCAGCACAGAAATATCATGG + Intronic
1193209105 X:78784893-78784915 GCTACATGACAGAAATATCATGG - Intergenic
1195157635 X:102140272-102140294 ACAGCAGCAGAGGAATATCATGG + Intergenic
1201937393 Y:19422974-19422996 GCTGCTGCACAGAGATATGATGG - Intergenic