ID: 1186637527

View in Genome Browser
Species Human (GRCh38)
Location X:11422424-11422446
Sequence CCATGTAAGGAGCACTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186637518_1186637527 27 Left 1186637518 X:11422374-11422396 CCAGGCAATGATAAGCTTGTGGA 0: 1
1: 0
2: 0
3: 10
4: 90
Right 1186637527 X:11422424-11422446 CCATGTAAGGAGCACTTGGAAGG 0: 1
1: 0
2: 1
3: 12
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186637527 Original CRISPR CCATGTAAGGAGCACTTGGA AGG Intronic
901066852 1:6498336-6498358 CCATGTAAGGAGTCCATGCAGGG - Intronic
902076746 1:13793133-13793155 CCAGGTAAGGAACACCTAGATGG - Intronic
903849479 1:26297408-26297430 CCAGGTAGGGGGCTCTTGGAGGG - Exonic
909814717 1:79977384-79977406 GCAAGTAAGGAGCAGTTGGATGG + Intergenic
909945955 1:81663092-81663114 CACTGTAAGGAGCACAGGGAGGG + Intronic
912114109 1:106383256-106383278 CCATGTTAGGAGCACATGTTAGG + Intergenic
913324583 1:117615603-117615625 CCATGTGAAGAGCCCTTGGAGGG + Intronic
920769972 1:208874879-208874901 CTATGTAAGGAGTGCTGGGAAGG - Intergenic
922561471 1:226572726-226572748 CCATGGCAGGAGCACTTGAGGGG - Intronic
1063504962 10:6589462-6589484 CCAGGGAAGGAGCACCAGGATGG + Intergenic
1068578027 10:58706995-58707017 TCATGCAAGGACCACTTGCAGGG - Intronic
1073115605 10:101089876-101089898 CCAGGGATGGAGCAATTGGAGGG + Exonic
1074834231 10:117273877-117273899 TCATGAAAGGGGCATTTGGAGGG + Intronic
1078114042 11:8426939-8426961 CCACATGAGGAGCACTGGGAAGG - Intronic
1080996957 11:37615368-37615390 CCATTTAAGGAAGACCTGGAGGG + Intergenic
1084179004 11:67437380-67437402 CCCTGTCAGGAGCCCTGGGAAGG - Intronic
1085173147 11:74465641-74465663 TCATGAAAGGAACACTTGAACGG - Intronic
1085264658 11:75230112-75230134 CTATACAATGAGCACTTGGAGGG - Intergenic
1085800518 11:79585187-79585209 CCATGCTTGGAGCACCTGGAGGG + Intergenic
1087668790 11:101081734-101081756 CCATGTAAGGATCTCTTGTAAGG - Intronic
1088833304 11:113556641-113556663 CCAGGGAAGGGGCACATGGATGG - Intergenic
1091643133 12:2252813-2252835 TCCTCTAAGGAGGACTTGGAAGG - Intronic
1093446772 12:19268741-19268763 CAATGTAAGGAACACTGGGTTGG - Intronic
1094172854 12:27512422-27512444 CCATTTATGTAGCATTTGGATGG - Intergenic
1100713736 12:97283968-97283990 AGATGTAAGGAGCACTCTGAAGG - Intergenic
1101201074 12:102436931-102436953 CCATATTGGGAGCACTGGGAGGG + Intronic
1102243985 12:111343368-111343390 CCCTGTAAAGAACACTTGGGGGG + Intronic
1104180914 12:126379808-126379830 CCATATAAGGATCACTTGCAGGG - Intergenic
1105420586 13:20248410-20248432 CTCTGTAAGGAGCAGTGGGATGG + Intergenic
1113088491 13:106592867-106592889 CCAGGTGAGAAGCACTTGGACGG - Intergenic
1113145547 13:107203741-107203763 CCAAGCCAGGAGCACTTGCAGGG - Intronic
1116086755 14:40250155-40250177 CCATGGAAGGAGCATTTAAATGG - Intergenic
1116087145 14:40254514-40254536 CCATGGAAGGAGCATTTAAATGG - Intergenic
1122266749 14:100550233-100550255 CCAAGGAAGGAGCCCTTGGCTGG + Intronic
1123510398 15:20992928-20992950 CCATAAAGGGAGCACTGGGATGG - Intergenic
1123567613 15:21566677-21566699 CCATAAAGGGAGCACTGGGATGG - Intergenic
1125261509 15:37830978-37831000 TCTTGGAAGGATCACTTGGATGG - Intergenic
1127327169 15:57906973-57906995 CCAGGTAAGAAGCTCCTGGAAGG - Intergenic
1129071695 15:72956780-72956802 CCATGTCTAGAGAACTTGGAGGG + Intergenic
1129193504 15:73951319-73951341 TTATGTAAAGAGCTCTTGGAAGG - Intronic
1202975976 15_KI270727v1_random:293772-293794 CCATAAAGGGAGCACTGGGATGG - Intergenic
1132634276 16:935790-935812 CGATGTAGGGAGCCCTGGGATGG - Intronic
1134179138 16:12033506-12033528 CCATGTAGGGAGCTCATGAATGG - Intronic
1135305872 16:21367280-21367302 CCATGTAGGGAGCTCATGAATGG - Intergenic
1136302614 16:29346431-29346453 CCATGTAGGGAGCTCATGAATGG - Intergenic
1137029482 16:35507974-35507996 CAAGGTATGGAGCACTTGGGGGG + Intergenic
1137738040 16:50739586-50739608 CCATGAAGGGAGGATTTGGAAGG + Intergenic
1138364277 16:56461101-56461123 CCATTTAATGAACACTTGGGTGG - Intronic
1138861207 16:60759654-60759676 CCATATCAGGAGCACTTAGGAGG + Intergenic
1141192576 16:81835073-81835095 CCAAGTAAGTGGCACCTGGAAGG - Intronic
1142808451 17:2384114-2384136 CCATGTAATAAGCACTTGCCTGG - Exonic
1150335217 17:64326097-64326119 AAATGGAAGGAGCCCTTGGAGGG + Intronic
1151540736 17:74763499-74763521 CCATCTCAGGAGCACCTGAATGG + Exonic
1155525051 18:26707420-26707442 CCATGTATTGAGCACTCGGTAGG + Intergenic
1156536798 18:37872185-37872207 CCATGTAAGGAGCAGGAAGAGGG + Intergenic
1156750210 18:40444060-40444082 CCATTGAAGGACCACTAGGATGG + Intergenic
1157392875 18:47317515-47317537 GCAGGTAAGGAGCACTTCGTGGG + Intergenic
1161310100 19:3589319-3589341 AGATGTAAGGAGGACTTTGAAGG + Intronic
1164941755 19:32256335-32256357 CCATGCAAGGACCACTGAGATGG + Intergenic
1165062708 19:33212626-33212648 CCATGTCAGGAGCACTGCGGAGG + Exonic
925306938 2:2854490-2854512 CCTTGTAAGCAGGACATGGAAGG - Intergenic
926505630 2:13711675-13711697 ACATCTAAAGAGGACTTGGAAGG + Intergenic
928069223 2:28198034-28198056 CCATGTAAGGATAAATTAGAAGG + Intronic
928413573 2:31072793-31072815 TCATGGAAGGAGCACTGGGGTGG - Intronic
929830801 2:45344742-45344764 CCATGTGGGGAGCAGTGGGAAGG - Intergenic
930004271 2:46883406-46883428 GCATGTGAGGAGCACCAGGATGG + Intergenic
932020290 2:68077778-68077800 CCATGTGAGGAGGACATGGTGGG - Intronic
935270436 2:101429837-101429859 CCAGGTAAGGAGGACCTGGGAGG + Intronic
937334724 2:121055097-121055119 CAATATCTGGAGCACTTGGAAGG - Intergenic
937703130 2:124886862-124886884 CAATGAAAGGAGCACTTCCATGG - Intronic
937968623 2:127533569-127533591 CCCTTGAAGGACCACTTGGAGGG - Intergenic
942344681 2:174990171-174990193 CAATGTCAGGAGCAATGGGAAGG - Intronic
947919616 2:233857672-233857694 GCATTTAAACAGCACTTGGAGGG - Intergenic
948893427 2:240917627-240917649 CCAGGCAAGGAGGACTTGGGTGG + Intergenic
949044825 2:241867555-241867577 CCACGTAAGCAGCTCTTGCAGGG + Intergenic
1171429276 20:25070521-25070543 CCATGTAGGGAGCCCTTGGAGGG - Intergenic
1171519507 20:25765145-25765167 CCAGGCAAGGAACACTGGGAAGG + Intronic
1171557413 20:26091348-26091370 CCAGGCAAGGAACACTGGGAAGG - Intergenic
1172160359 20:32863725-32863747 CGTTGTAAGGACCACGTGGAAGG - Intronic
1172810657 20:37645540-37645562 TCATGAAAGGAGCACTGGGCTGG + Intergenic
1173168538 20:40703761-40703783 CCATGTAAAGAGCCCAGGGAAGG + Intergenic
1175383154 20:58577407-58577429 CCATGGCAGGAGCGCTTGGAGGG + Intergenic
1176033824 20:63026766-63026788 CCATTTAAGGAGCAGGTTGAAGG + Intergenic
1176380025 21:6107767-6107789 CCATTTAAGCAGCCCGTGGAAGG + Intergenic
1179743449 21:43430471-43430493 CCATTTAAGCAGCCCGTGGAAGG - Intergenic
1180623914 22:17181344-17181366 CCCTGTGAGAAGCACTTGGCTGG - Exonic
1181562445 22:23713833-23713855 CTTTGTAAGGAGGACTTGGTAGG - Intergenic
1183809352 22:40241020-40241042 ACATGTTAGAACCACTTGGAGGG + Intronic
950642622 3:14358417-14358439 CCGTGTGAGCAGCACTAGGAGGG - Intergenic
950885858 3:16362334-16362356 CCATGGAATAAGCACTTGGGAGG - Intronic
951538583 3:23761610-23761632 CCATAGAGGGAGCACTGGGATGG - Intergenic
952120205 3:30232987-30233009 CCATTTGAGGGGCACATGGAGGG + Intergenic
956160545 3:66346858-66346880 CTGTGTAAGGACCACTTGGATGG + Intronic
957142096 3:76373466-76373488 TCTTGGATGGAGCACTTGGATGG + Intronic
957602490 3:82356127-82356149 CCAAGTAAGCAGGCCTTGGAGGG - Intergenic
958707894 3:97679142-97679164 TCATCTAAAGAGCAATTGGAAGG - Intronic
959550751 3:107653961-107653983 CCATGCAGGTAGCACCTGGATGG + Intronic
961555776 3:127695980-127696002 CCATGCTAGGAGCCCCTGGAGGG + Intronic
961935256 3:130576011-130576033 CCATCTAAGAAGCCCCTGGAGGG - Intronic
965811885 3:172599898-172599920 CCTTATAAGGAGCAGGTGGAGGG - Intergenic
969244728 4:5924928-5924950 CCTGGGAAGGAGCACTTGGGTGG + Intronic
969832991 4:9813554-9813576 ACATGTAAGGAGCACTTATGAGG + Intronic
970423288 4:15924587-15924609 CCATGTAAGGAGGAATGGGAAGG - Intergenic
971009812 4:22421371-22421393 TAATTTAAGGAGCACTTCGAAGG + Intronic
971420403 4:26469019-26469041 CCATGTAAGGGGCATTAGTAAGG + Intergenic
972010710 4:34177615-34177637 CCAGGAAAGGAGCACTTGAAAGG + Intergenic
973919312 4:55668662-55668684 CCATGTGAGAAGCAGCTGGAAGG + Intergenic
975533851 4:75428138-75428160 TGATGTAAGGAGCAAATGGAAGG + Intergenic
975815400 4:78211557-78211579 CCAGGTGAAGAGCCCTTGGAAGG - Intronic
976544012 4:86312400-86312422 GTGAGTAAGGAGCACTTGGAAGG - Intronic
985010590 4:185578716-185578738 CCATGGAAGCAGCCCTTGCAAGG + Intergenic
987815393 5:22894460-22894482 GCATGTAAGGAGGAGTTGGTTGG + Intergenic
990128643 5:52551389-52551411 CAATGTGAGGAGGACTTGGAAGG + Intergenic
990946819 5:61257948-61257970 CCATCTGAGGAGCACTTTTAGGG - Intergenic
991270003 5:64768486-64768508 CCAGGTAAGGAGCAATTACAGGG - Exonic
994720109 5:103370794-103370816 CCATGTCATGAGCCCTTGGCAGG + Intergenic
994740140 5:103607867-103607889 CCAAGTTAGAAGCACTTGAATGG + Intergenic
996897126 5:128498179-128498201 CCATGCAAGAATCACTTTGATGG - Intronic
998572054 5:143270064-143270086 CAATGAAAGTAGCACTTAGATGG - Intergenic
1000752932 5:165119239-165119261 CCATGCAAGGATGACATGGAAGG - Intergenic
1001106431 5:168858528-168858550 CTATGTAAGTGGCATTTGGATGG - Intronic
1005985188 6:30868671-30868693 CCATGTAAGAAGCAGCCGGATGG - Intergenic
1008617861 6:53243575-53243597 GTATGTAAGGAGCACCAGGAGGG + Intergenic
1009023733 6:57972975-57972997 CCATGCAAAGAGGACTTGGTGGG - Intergenic
1009199309 6:60724527-60724549 CCATGCAAAGAGGACTTGGTGGG - Intergenic
1010360782 6:74991081-74991103 CCATTTAAGGGTCACTTGCAAGG - Intergenic
1012218874 6:96623706-96623728 CCATGTAAGAAGCAGCTAGATGG + Intergenic
1018529694 6:164749745-164749767 CCATGTAAGGAGCAAAGTGATGG + Intergenic
1019006324 6:168799746-168799768 CCAGGTGAGGAGAACATGGAGGG - Intergenic
1023476945 7:40590800-40590822 CCATGTACGGAGCACAGGCAAGG - Intronic
1028359531 7:89951063-89951085 CCATGTCTAGGGCACTTGGAGGG - Intergenic
1031059840 7:117038686-117038708 ACATGTATCGAGCACTTGGAAGG + Intronic
1031185282 7:118472057-118472079 CCATGTAAGCTGCCCTGGGAAGG + Intergenic
1037182568 8:16025141-16025163 CCATGTCAGGACAACTTGCAAGG - Intergenic
1045331268 8:101157701-101157723 CCATGTAGCTAGCACATGGAAGG + Intergenic
1047813514 8:128436291-128436313 CCATGTGAGGACCACAGGGAGGG + Intergenic
1049165367 8:141122263-141122285 GCAAGTCAGGAGCACTGGGATGG - Intronic
1050265640 9:3886806-3886828 CCCTGTCAGGGTCACTTGGAAGG + Intronic
1051171748 9:14324391-14324413 ACATGTAAGTAACACTTGCATGG + Intronic
1052988609 9:34505572-34505594 TCATGCAAGAGGCACTTGGAGGG - Intronic
1055247678 9:74266400-74266422 CCATGAGAGGAGAACATGGAGGG - Intergenic
1056663543 9:88562353-88562375 CCATGTAACCAGCACCTAGATGG - Intronic
1057394047 9:94663752-94663774 CCATGTAATTATCTCTTGGAAGG - Intergenic
1058259051 9:102808152-102808174 CCATGACAGGAACACTGGGAGGG - Intergenic
1060789965 9:126479283-126479305 CCATCTCAGCAGCACTAGGAAGG + Intronic
1061849283 9:133405001-133405023 ACAGGGAAGGAGCACATGGAAGG + Intronic
1186637527 X:11422424-11422446 CCATGTAAGGAGCACTTGGAAGG + Intronic
1188555648 X:31409287-31409309 CCATGTGAGCAGCTCTAGGATGG - Intronic
1188617502 X:32176448-32176470 CCATATTAGGAGCACCTTGAAGG - Intronic
1189120391 X:38388027-38388049 CCTTGTAAGCAGCCCTTTGAAGG + Intronic
1192467481 X:71367499-71367521 GAATGTAAGAAGCACTTGGCAGG + Exonic
1193394928 X:80972146-80972168 ACATGTAAAGATCACATGGAGGG - Intergenic
1194963862 X:100266169-100266191 ACATGTAAGCATCACTGGGAGGG - Intergenic
1196714116 X:118794743-118794765 CTTTGTAAGCAGCACTTGAAGGG + Intergenic
1198488792 X:137116722-137116744 TCATTTTGGGAGCACTTGGAAGG + Intergenic
1199256761 X:145726309-145726331 CCTTGTAAGCAGCACTTGTACGG + Intergenic