ID: 1186646933

View in Genome Browser
Species Human (GRCh38)
Location X:11517242-11517264
Sequence AAATATCTTAAGCTTAGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186646931_1186646933 18 Left 1186646931 X:11517201-11517223 CCTTCTTGGCAGAGGCTCAAGAC No data
Right 1186646933 X:11517242-11517264 AAATATCTTAAGCTTAGGCTAGG No data
1186646929_1186646933 28 Left 1186646929 X:11517191-11517213 CCAGGCATGACCTTCTTGGCAGA No data
Right 1186646933 X:11517242-11517264 AAATATCTTAAGCTTAGGCTAGG No data
1186646928_1186646933 29 Left 1186646928 X:11517190-11517212 CCCAGGCATGACCTTCTTGGCAG No data
Right 1186646933 X:11517242-11517264 AAATATCTTAAGCTTAGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186646933 Original CRISPR AAATATCTTAAGCTTAGGCT AGG Intronic