ID: 1186648109

View in Genome Browser
Species Human (GRCh38)
Location X:11528899-11528921
Sequence GGTTGGTTTTAGTAATGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 234}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186648109_1186648115 28 Left 1186648109 X:11528899-11528921 CCAAAACATTACTAAAACCAACC 0: 1
1: 0
2: 0
3: 15
4: 234
Right 1186648115 X:11528950-11528972 CAGTGTAACTGTCAGTGGAGTGG 0: 1
1: 0
2: 0
3: 14
4: 169
1186648109_1186648111 -4 Left 1186648109 X:11528899-11528921 CCAAAACATTACTAAAACCAACC 0: 1
1: 0
2: 0
3: 15
4: 234
Right 1186648111 X:11528918-11528940 AACCCAGAAATAAAAGAAAATGG 0: 1
1: 2
2: 10
3: 146
4: 1801
1186648109_1186648114 23 Left 1186648109 X:11528899-11528921 CCAAAACATTACTAAAACCAACC 0: 1
1: 0
2: 0
3: 15
4: 234
Right 1186648114 X:11528945-11528967 CAAATCAGTGTAACTGTCAGTGG 0: 1
1: 0
2: 0
3: 14
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186648109 Original CRISPR GGTTGGTTTTAGTAATGTTT TGG (reversed) Intronic
900439010 1:2644135-2644157 GGTTGATTTCAGTTAGGTTTGGG - Intronic
902188302 1:14741953-14741975 GGTTGTTTTTTGTTTTGTTTAGG + Intronic
905032032 1:34891387-34891409 GCTGGGTTTCAGCAATGTTTGGG + Intronic
908284287 1:62577573-62577595 GGTTAGTAATAATAATGTTTTGG - Intronic
909590369 1:77341883-77341905 GTTTGGTTTTTGTTTTGTTTTGG + Intronic
909720700 1:78766559-78766581 GGTTACTTTTATTCATGTTTGGG + Intergenic
910707213 1:90142659-90142681 TGTTGATTTTATTAATCTTTAGG + Intergenic
911205456 1:95087842-95087864 GTTTTGTTTTTGTAATTTTTAGG - Intergenic
911572958 1:99540019-99540041 GGTGGGTTTTGGCAATCTTTTGG - Intergenic
911634821 1:100223363-100223385 AGTTGGTTTTAGTTTTGTTTTGG + Intronic
913305563 1:117427637-117427659 GGTTGGTATTTATCATGTTTAGG - Intronic
917553181 1:176057496-176057518 GATTGGTTTTCGTATTTTTTTGG + Intronic
917781592 1:178403232-178403254 GTTTGGTTTTAATAATTTTGAGG + Intronic
917805758 1:178612045-178612067 AATTGGTTTGAGTAATTTTTTGG - Intergenic
918464770 1:184810095-184810117 GGATCATTTTAGAAATGTTTTGG - Intronic
918505427 1:185248980-185249002 ATTTGTTTTTTGTAATGTTTTGG + Intronic
920662223 1:207925041-207925063 TGTGGATTTTAGTCATGTTTTGG - Intergenic
1064038682 10:11938490-11938512 GTTTTGTTTGAGTAATGGTTTGG - Intronic
1064659133 10:17588004-17588026 GGTTGGTTTTATACATTTTTAGG - Intergenic
1064830692 10:19462572-19462594 TTTAGGTTTTAGTAATATTTAGG - Intronic
1065995081 10:31051968-31051990 GGTTGGATTTATTAAAGCTTAGG + Intergenic
1066212880 10:33257240-33257262 GGTTGCTTTTGGTGATGTCTTGG - Intronic
1066723146 10:38360711-38360733 GGTTGGTGTTATTCAAGTTTAGG + Intergenic
1067416030 10:46103903-46103925 GGTTAGTTTTTGTATTTTTTTGG + Intergenic
1067916199 10:50401605-50401627 GGTTGGTTGGTGTAAAGTTTTGG - Intronic
1072037099 10:91573501-91573523 TGTTTGTTTAAGTAATATTTTGG - Intergenic
1072075979 10:91974247-91974269 GGTTATCTTTAGTAATTTTTTGG + Intronic
1072231407 10:93416948-93416970 GGTTGGATTTAATAATATGTAGG - Intronic
1073619435 10:105031374-105031396 TGTTTGTTTTACAAATGTTTAGG + Intronic
1074937492 10:118198687-118198709 TATTAGTTGTAGTAATGTTTAGG + Intergenic
1075473870 10:122716214-122716236 GGTTGCTTTTAGTACTGATGGGG - Intergenic
1075959948 10:126559701-126559723 GGTTGGTTTTTTAAATGATTAGG - Intronic
1077403487 11:2370282-2370304 GGTTGGTTTTATTGGTATTTTGG + Intergenic
1077944801 11:6884644-6884666 GGTTGGTTTTAGGCTTTTTTAGG - Intergenic
1078099423 11:8320960-8320982 AGTGGGTTTTGGTAATGATTGGG + Intergenic
1079172350 11:18108380-18108402 TATTGGTTTTAGTAAGGTTTGGG + Intergenic
1079428115 11:20363396-20363418 GGTTTGTTTTATTCCTGTTTGGG + Intergenic
1080593746 11:33748992-33749014 GGTTGGGTTTCTTAATTTTTTGG - Intronic
1081290948 11:41324859-41324881 GAATGGATTTAGTAATATTTGGG + Intronic
1081916318 11:46733236-46733258 GATTGGTTTTAATAGTGTTATGG - Intronic
1085048831 11:73368951-73368973 GTTTGGTTTTGGTTTTGTTTGGG + Exonic
1086763969 11:90671356-90671378 GTTAGATTTGAGTAATGTTTTGG + Intergenic
1086890418 11:92252014-92252036 GGTTACTTTTAGAGATGTTTAGG + Intergenic
1087918633 11:103839895-103839917 GGTTAGTTTTAGAAAGTTTTTGG + Intergenic
1088339488 11:108746885-108746907 GGTTTGCTATAGAAATGTTTTGG + Intronic
1088371551 11:109094095-109094117 TGTTGGTTTTTGTAAATTTTTGG + Intergenic
1089235839 11:117024407-117024429 GGCTATTTTTAGTAATCTTTAGG - Intronic
1091816701 12:3444311-3444333 CCTTGCTTTTAGTACTGTTTTGG + Intronic
1091969925 12:4778642-4778664 GGTAGGTTTAAGCAATGTTAGGG - Intronic
1093645266 12:21579083-21579105 TGTTGGGTTTGGTAATATTTGGG - Intronic
1094670498 12:32563835-32563857 GATTGGTTTTCGTACTTTTTTGG - Intronic
1095114031 12:38331107-38331129 GATTGGTTTTCGTATTTTTTTGG - Intergenic
1095911751 12:47434171-47434193 GCTTGGTTTTGGTAATGGTAAGG - Intergenic
1098316756 12:69201204-69201226 GGTTGGTTTTAGTTTTTTCTGGG - Intergenic
1099227025 12:79982019-79982041 GGTTGGTTTTAGTGAAGTCGAGG - Intergenic
1099761164 12:86922048-86922070 GGTTGGTTTTATTCATTTTAGGG + Intergenic
1100232379 12:92621332-92621354 GGTTGGTTTTAGTTTTTTTCTGG + Intergenic
1100308707 12:93375049-93375071 GGTTGGTTTTTGCAATTATTGGG - Intergenic
1101977404 12:109372186-109372208 GGTTGTTTTTAGTCATACTTAGG + Intronic
1103619567 12:122178533-122178555 GATGGGTTGTAGAAATGTTTAGG + Intronic
1105506762 13:21016902-21016924 AGTTGGTTTTACTTATCTTTGGG - Intronic
1105676149 13:22673645-22673667 GGTTGGTAGTAGTAATGTGAAGG + Intergenic
1107242170 13:38249465-38249487 GGTTGGTTTTAGAACTTATTAGG - Intergenic
1108306797 13:49144493-49144515 GTTTGGTTTTAGAAATGCTAAGG + Intronic
1108863630 13:54894859-54894881 TGTTGGATCTAGTAATGTGTAGG - Intergenic
1109178956 13:59190078-59190100 TGTTAGTTTTACTACTGTTTTGG + Intergenic
1109184206 13:59249652-59249674 GGTTGGTTATAGTCACATTTTGG - Intergenic
1109281348 13:60359487-60359509 GATTTATTTTAATAATGTTTAGG - Intergenic
1111074289 13:83212562-83212584 TGTTGGTTTTAGAATTGCTTTGG - Intergenic
1111375252 13:87370044-87370066 GATTCTTTTTATTAATGTTTAGG - Intergenic
1111719965 13:91930672-91930694 GTTTGCATTTAGTACTGTTTAGG - Intronic
1111854431 13:93619614-93619636 GCTAGTTTTTAGAAATGTTTTGG + Intronic
1115371796 14:32623954-32623976 GGTTGGTTTGTGCAAAGTTTTGG + Intronic
1116192188 14:41675437-41675459 GACTGGTTTTCGTAATTTTTTGG - Intronic
1118491143 14:66261817-66261839 TGTTAGTTTTAATAATCTTTTGG + Intergenic
1120688868 14:87570193-87570215 TGTTGGTTTTAAGAATATTTGGG - Intergenic
1122055587 14:99096128-99096150 GGTTTGTTTTTGAAATGTCTGGG - Intergenic
1123503139 15:20910180-20910202 GGTTGGTTTCAGTGATAGTTTGG + Intergenic
1123560385 15:21483845-21483867 GGTTGGTTTCAGTGATAGTTTGG + Intergenic
1123596626 15:21921146-21921168 GGTTGGTTTCAGTGATAGTTTGG + Intergenic
1124127634 15:26951475-26951497 GCTTGGTTTTATACATGTTTGGG - Intergenic
1124909871 15:33909089-33909111 AGTTGGTTTTTGTTTTGTTTTGG + Intronic
1129998267 15:80025570-80025592 TGTAGGTTTTATTACTGTTTAGG + Intergenic
1130632568 15:85583433-85583455 TTTTAGTTTTATTAATGTTTTGG + Intronic
1131294819 15:91138149-91138171 GGTTGGTTTTTGTTATTGTTGGG - Intronic
1202968735 15_KI270727v1_random:211009-211031 GGTTGGTTTCAGTGATAGTTTGG + Intergenic
1133680277 16:8114575-8114597 GGCTGGTTTTTGTATTTTTTTGG + Intergenic
1138043250 16:53697523-53697545 GGCTGGTTTTCGTATTTTTTTGG + Intronic
1141687956 16:85581093-85581115 GGATGGTTTTAATAAGGATTTGG + Intergenic
1143279266 17:5739099-5739121 AGTTGGTTTTGGTCTTGTTTGGG + Intergenic
1143567061 17:7729085-7729107 GTTTGGTTTTTTTAATTTTTCGG - Intronic
1146021595 17:29283804-29283826 GGTTGTTTTTAGCAATGTTAGGG - Intronic
1146915471 17:36675663-36675685 GGCTGGTTTTGGCAAAGTTTTGG + Intergenic
1147191902 17:38742717-38742739 GGATGGTTGTAATAATATTTGGG - Intronic
1149146998 17:53505996-53506018 GCTTGGTTTTAGTAGTAATTGGG + Intergenic
1149459930 17:56820234-56820256 GTTTGATATTAGAAATGTTTTGG - Intronic
1149761907 17:59239681-59239703 GGCTATTTTTAGAAATGTTTAGG - Intronic
1153468468 18:5416039-5416061 GGTTGGTTTCAGAAAGGTTGGGG + Exonic
1154050443 18:10951201-10951223 CTTTGGTATTAGTAAAGTTTTGG - Intronic
1155703404 18:28778340-28778362 GGGTAGTTTTTGTAATATTTAGG - Intergenic
1156036314 18:32770909-32770931 GGTTGGTTTTAGGAAAGTGAGGG - Intronic
1158143773 18:54286959-54286981 GGTTGCTTTTAGTTTTGTTTTGG + Intronic
1161019884 19:2004180-2004202 GGTTGGTTTTATACATGTTAGGG - Intronic
1163816683 19:19470111-19470133 GTTTGGCTCTAGTAATTTTTTGG - Intronic
1168420867 19:56202401-56202423 GGTTGGTTTCAGAAAGATTTGGG + Intronic
926928378 2:18011482-18011504 GTTAGGTTTTATTAATGATTAGG - Intronic
926957805 2:18320608-18320630 GTTTGGATTTAGCAAAGTTTAGG - Intronic
928811259 2:35229681-35229703 TATTGGTTTAAGTAATGTTAAGG + Intergenic
930401024 2:50888192-50888214 GGTTTGTTGTTTTAATGTTTGGG - Intronic
930751667 2:54940366-54940388 TGTTTGTTTTGGTCATGTTTTGG + Intronic
931876166 2:66515404-66515426 AGTTGGTTTTTGTTTTGTTTTGG - Intronic
934062668 2:88310085-88310107 CATTGGTGTTGGTAATGTTTTGG + Intergenic
936500682 2:113063698-113063720 GGTTGGTTGTAGTAGTGATCAGG + Exonic
937226213 2:120371273-120371295 GTATGATTTTTGTAATGTTTTGG + Intergenic
937981346 2:127617827-127617849 GGTTGGTTTTAGTTTTTTCTGGG + Intronic
938840531 2:135157882-135157904 GCTTGGTTTTTGTAATGATACGG + Intronic
938993035 2:136648724-136648746 GGTTGGCTTTACTGCTGTTTTGG + Intergenic
938993331 2:136652003-136652025 TGCTGGTTTTATTACTGTTTTGG + Intergenic
939095027 2:137824591-137824613 GTTTGGCTTTAGAAATTTTTTGG - Intergenic
939978454 2:148748468-148748490 GGTTTGATTTAGTGATGTTTGGG - Intronic
940333144 2:152497444-152497466 TGTTGGTTTTATTTATTTTTAGG + Intronic
941542314 2:166801901-166801923 GGTTGGGTATATTTATGTTTAGG + Intergenic
942570979 2:177313995-177314017 GGTTGGTTGTAAGAATCTTTGGG + Intronic
943226920 2:185189196-185189218 GGTTGATTTTTGTATTGTTAAGG + Intergenic
943306132 2:186264879-186264901 GGTTGTTTTTAGGAAGGTTTGGG - Intergenic
943433053 2:187828130-187828152 TGTTTGTTTTATTATTGTTTTGG + Intergenic
943852567 2:192744193-192744215 GTTTTATTTTAGAAATGTTTGGG + Intergenic
944303781 2:198156473-198156495 GGTTGGTATTTGATATGTTTTGG + Intronic
944814203 2:203358835-203358857 GGTTTGTTTTAGTAGAGATTGGG - Intronic
947347215 2:229205168-229205190 GGTTGGCTGTATAAATGTTTAGG - Intronic
947676885 2:231990060-231990082 GGTTTCTTTTTGTAATGTATGGG - Intronic
947911767 2:233805256-233805278 TGGTGGTTTTAGTTTTGTTTTGG + Intronic
1169441903 20:5639835-5639857 GACTGGTTTTCGTATTGTTTTGG - Intergenic
1174729893 20:52905517-52905539 GGTTGGGCTTGGTGATGTTTGGG + Intergenic
1175370789 20:58489182-58489204 TGTTGGTTTGGGTTATGTTTGGG - Intronic
1177016559 21:15796353-15796375 GGTTGGTTTTATTTCTGTTTTGG - Intronic
1177603912 21:23354473-23354495 GGGTGGGTTTAATAGTGTTTTGG + Intergenic
1179783132 21:43715423-43715445 GGTTGGTTTTAGACATTTTAGGG - Intergenic
1182624001 22:31632810-31632832 GGTTAATATTAGAAATGTTTGGG + Intronic
1183692084 22:39396137-39396159 GGATGGTTTGAGAAATATTTAGG - Intergenic
1185097900 22:48821629-48821651 GATTGGTTTGAGAAAGGTTTGGG - Intronic
949908022 3:8874919-8874941 TCTTGGTATTAGTATTGTTTGGG - Intronic
950895363 3:16444935-16444957 GTTTAGTATTAGAAATGTTTTGG + Intronic
952750839 3:36823655-36823677 GTATGGTTTTAATAATGTTGGGG - Intergenic
957979636 3:87492232-87492254 TGTTGTTTTTAGAAATGTCTGGG - Intergenic
958725664 3:97902843-97902865 GTTTGGTTTTTGTTTTGTTTGGG - Intronic
959144325 3:102525498-102525520 GGTTGCTTTTAATATTTTTTAGG - Intergenic
960825079 3:121774048-121774070 GGTTGTTTTTTGTAGAGTTTTGG - Intronic
960920858 3:122746814-122746836 GGCTGGTTTTCGTATTTTTTTGG + Intronic
965632589 3:170748253-170748275 GTTTGGTTATAATAATATTTTGG + Intronic
966938709 3:184731590-184731612 GATTGATTTGAGAAATGTTTAGG + Intergenic
971414828 4:26414955-26414977 GCTTAGTTTTATTAATATTTTGG + Intronic
971461584 4:26904552-26904574 CATTGGATTTAGTAATGTTGAGG + Intronic
971481939 4:27122830-27122852 GCTTGGTTTTATTCATTTTTGGG - Intergenic
975104645 4:70554024-70554046 GGTTGGTTTTAGTTTTTTCTGGG + Intergenic
977873897 4:102126412-102126434 GCTTGAGTTTAGTAATTTTTTGG - Intergenic
978146130 4:105374038-105374060 AGTTGGGATTAGTAATCTTTTGG - Intronic
978487915 4:109276914-109276936 GGTTGGTGGTAGTGATGTTAAGG - Intronic
979001388 4:115225336-115225358 TGTTGGTTTTGGTGAGGTTTTGG - Intergenic
979622234 4:122811353-122811375 GATTGGTTTTCGTATTTTTTTGG + Intergenic
979931175 4:126632795-126632817 TGTTGCTTCTAGCAATGTTTAGG - Intergenic
980519912 4:133917985-133918007 GGGTAGTATTAGTGATGTTTTGG - Intergenic
980919161 4:139064978-139065000 GGTTTGTTTTAATAGTTTTTAGG - Intronic
984310837 4:178056052-178056074 GATTAGTTTTATTGATGTTTTGG - Intergenic
985011420 4:185586516-185586538 AGTTGGTTTTAGCAAGGATTAGG - Intronic
985297452 4:188450326-188450348 TGTTGTTTTTAGAAATATTTTGG - Intergenic
986595207 5:9414629-9414651 GGTAGGTTCTGCTAATGTTTTGG - Intronic
987016471 5:13825178-13825200 GGTTAATTTTTGTAATTTTTTGG - Intronic
987342175 5:16948914-16948936 GGTTGGTTTTTGTTTTGTTTTGG + Intergenic
988122104 5:26977987-26978009 GTTTGGTTTTAGAAATTTCTAGG - Intronic
988698371 5:33647428-33647450 GGTGGATTTTAGAAATATTTAGG + Intronic
990141044 5:52704666-52704688 GGCTATTTTTAGTATTGTTTTGG + Intergenic
990478094 5:56181544-56181566 GGTTTGTTTTAGGGATGTTAGGG - Intronic
990788055 5:59445036-59445058 GCTTGGTTTTAGAGATGTTTTGG - Intronic
992574323 5:78096172-78096194 GGCTGGTTTTCGTATTTTTTTGG + Intronic
992855849 5:80861274-80861296 GTTAGGTTTTAGTAATGTGCTGG + Intronic
993938688 5:94033019-94033041 TGATGGTTTTAGAAGTGTTTTGG + Intronic
994543758 5:101135140-101135162 AGTTGCTTTTTGTAATGTCTGGG + Intergenic
995004646 5:107177222-107177244 GGGTGCTTTTAGTATTGGTTAGG - Intergenic
996386417 5:122913944-122913966 GACTGGTTTTAGTAATTTTTTGG - Intronic
996464246 5:123781339-123781361 TTTTGGTTTAAGGAATGTTTGGG - Intergenic
997664987 5:135623456-135623478 GGTTGGTCTCAGTCAGGTTTGGG + Intergenic
998753925 5:145354647-145354669 GGTGGGTTTTATTATTGTTGGGG - Intergenic
998922878 5:147089304-147089326 GTTTTGTTTCAGTAAAGTTTCGG - Intergenic
999240559 5:150124976-150124998 AGGTGGTTTAAGTAATGTCTAGG - Intronic
999532789 5:152480644-152480666 GATTGGTTTTAGTATTTTTTTGG - Intergenic
1004840359 6:19577095-19577117 GCTAGGTTTTAGAATTGTTTAGG - Intergenic
1005507281 6:26480592-26480614 GGTTGGCTTTATTAGTGTTTTGG + Intergenic
1007890735 6:45287858-45287880 AGTTGCTTTAAGTAATTTTTAGG - Intronic
1008377744 6:50810603-50810625 GATTGGTTTTCGTATTTTTTTGG - Intergenic
1010137894 6:72576595-72576617 ATTTGGTATTATTAATGTTTAGG - Intergenic
1013556369 6:111260488-111260510 GGTTGGTTTTATTAATAAATAGG - Intronic
1013664844 6:112337145-112337167 CGATGGTTTTAGGAATGGTTGGG - Intergenic
1014261099 6:119218182-119218204 TTTTGATTTTAGTCATGTTTTGG + Intronic
1014266091 6:119279383-119279405 AGTTGGTTTTAGTTAAGGTTTGG - Intronic
1020220785 7:6235028-6235050 GGTGGGTGTGAGTAAGGTTTTGG - Intronic
1021940582 7:25674978-25675000 GGTTGCATTTGGCAATGTTTGGG - Intergenic
1022264716 7:28742621-28742643 TGTTGGTGTTAGTAATGATGAGG - Intronic
1023539434 7:41249812-41249834 TGTTATTTTAAGTAATGTTTTGG + Intergenic
1023798097 7:43810640-43810662 AGTTGTTTTAAGTAAAGTTTCGG - Intergenic
1026055378 7:66979226-66979248 GGATTGATTTAGAAATGTTTGGG + Intergenic
1026626396 7:71996166-71996188 GTTTAGGTTTAGTCATGTTTAGG - Intronic
1026722322 7:72842601-72842623 GGATTGATTTAGAAATGTTTGGG - Intergenic
1027279570 7:76597124-76597146 GGTTTATTTTAGTTCTGTTTAGG - Intergenic
1029334727 7:99889043-99889065 GATTGGTTTTCGTATTTTTTTGG - Intronic
1030189825 7:106799818-106799840 GTGTGACTTTAGTAATGTTTGGG - Intergenic
1030931579 7:115529931-115529953 TGTTGGCTTTTTTAATGTTTTGG - Intergenic
1033293930 7:140114329-140114351 GATTGGTTTTCGTATTTTTTTGG + Intronic
1034505543 7:151486954-151486976 GTTGGGTTTTAGGGATGTTTTGG + Intronic
1038066014 8:23964522-23964544 GTATGGTTTTAGCAATGATTTGG + Intergenic
1040853149 8:51922928-51922950 GGTTGGTTTTACAAATTTTAGGG + Intergenic
1041399902 8:57431243-57431265 GGTTTGTTTTAGCAGTGTTGTGG - Intergenic
1041454831 8:58047357-58047379 GGATGTTTGTAGTAAGGTTTGGG + Intronic
1041642188 8:60215179-60215201 TGTTAGATTTGGTAATGTTTTGG + Intronic
1041683921 8:60624861-60624883 GGTTGACTTTAATTATGTTTGGG - Intergenic
1041879515 8:62733167-62733189 GTGAGGTTTTAGTATTGTTTAGG - Intronic
1042139195 8:65662259-65662281 GATTGGTTTTCGTATTTTTTTGG + Intronic
1042784699 8:72535413-72535435 GGTGGGTTTTTGTTTTGTTTTGG - Intergenic
1043735717 8:83740461-83740483 GGTAGGTTTTAGAATTGTTTGGG - Intergenic
1043772031 8:84215722-84215744 GGTTGGCTTTAGTGATTTCTGGG + Intronic
1044011074 8:86994790-86994812 GGTTGGTTTTGTTGATATTTTGG + Intronic
1044417997 8:91957937-91957959 AGTTGGTTTTAATTTTGTTTGGG - Intronic
1045504444 8:102768669-102768691 GGTTGGCTTCAGTCATCTTTAGG - Intergenic
1045513881 8:102839312-102839334 GCTTCTTTTTAGTAATGTTTAGG - Intronic
1046448746 8:114359425-114359447 CGTTGGTTATAGATATGTTTAGG - Intergenic
1046818274 8:118609029-118609051 GTTTTATTTTAGAAATGTTTGGG - Intronic
1050086710 9:1973400-1973422 GGTTGGATTTAATTAAGTTTAGG - Intergenic
1050860897 9:10428978-10429000 GGTTGGTTGTGGCAATGTCTGGG + Intronic
1053078824 9:35157293-35157315 GCTTGGTTTTATAAATTTTTGGG - Intergenic
1054893831 9:70284460-70284482 GGTTGGTTATAGTTAAGTTGTGG + Intronic
1054919711 9:70530007-70530029 GGCTGGTTTTAATGATGTGTGGG + Exonic
1056650627 9:88458004-88458026 GTTTGGTTTTAGTGTTGCTTTGG + Intronic
1056765257 9:89441216-89441238 GGTTGGTATTCGTAAGGTCTGGG - Intronic
1058499270 9:105593823-105593845 CGTTGGATTTAGCAATGTTCAGG + Intronic
1059030660 9:110692148-110692170 GGTTGGTTTTTGTTTTGTTTTGG + Intronic
1061472495 9:130837462-130837484 GGCTGGTTTAATTATTGTTTTGG + Intronic
1061640258 9:131948522-131948544 GGTTGGTTGGTGTTATGTTTTGG - Intronic
1185853996 X:3516782-3516804 GGTTCTTATTAGTTATGTTTTGG + Intergenic
1186415912 X:9382779-9382801 GGTTGGCCTGAGTAATGATTTGG - Intergenic
1186648109 X:11528899-11528921 GGTTGGTTTTAGTAATGTTTTGG - Intronic
1187310325 X:18135438-18135460 GGTTGGTTCTTGGAATGTTGGGG + Intergenic
1187401815 X:18966984-18967006 GGTGGGCTTGAGGAATGTTTAGG + Intronic
1187544805 X:20238917-20238939 GGTTGGTTTTATTAGAGATTAGG + Intronic
1191637222 X:63392596-63392618 GACTGGTTTTCGTAATTTTTTGG + Intergenic
1192311372 X:70017575-70017597 TGTTGTTTTTAGTTTTGTTTAGG - Intronic
1193240185 X:79159271-79159293 GTTTGGTAGTAGTAATGGTTGGG - Intergenic
1193826191 X:86230327-86230349 GGTTGGTTTTTGATATGTTGTGG + Intronic
1195378665 X:104251082-104251104 TGTTGGCTTTGGTTATGTTTAGG - Intronic
1196287097 X:113895757-113895779 GGATAGTTTTTGTGATGTTTGGG + Intergenic
1200404873 Y:2799664-2799686 GGTTGCTTTCAGTCATGTTGAGG + Intergenic