ID: 1186653704

View in Genome Browser
Species Human (GRCh38)
Location X:11589926-11589948
Sequence GGTAATTATACAGCCTTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186653703_1186653704 -7 Left 1186653703 X:11589910-11589932 CCATTGGAATTTACAAGGTAATT 0: 1
1: 0
2: 1
3: 33
4: 312
Right 1186653704 X:11589926-11589948 GGTAATTATACAGCCTTTGATGG 0: 1
1: 0
2: 0
3: 8
4: 125
1186653702_1186653704 -6 Left 1186653702 X:11589909-11589931 CCCATTGGAATTTACAAGGTAAT 0: 1
1: 0
2: 0
3: 13
4: 214
Right 1186653704 X:11589926-11589948 GGTAATTATACAGCCTTTGATGG 0: 1
1: 0
2: 0
3: 8
4: 125
1186653699_1186653704 30 Left 1186653699 X:11589873-11589895 CCTGAAGCTCAGCGATGAGACAA 0: 1
1: 0
2: 0
3: 6
4: 125
Right 1186653704 X:11589926-11589948 GGTAATTATACAGCCTTTGATGG 0: 1
1: 0
2: 0
3: 8
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186653704 Original CRISPR GGTAATTATACAGCCTTTGA TGG Intronic
907995915 1:59632548-59632570 GGGATTTGTACAGCCTTTAATGG - Intronic
911922829 1:103788755-103788777 GGGAATTTCACAGACTTTGATGG - Intergenic
914017229 1:143831407-143831429 GGTAATAATACCGCATTTGCAGG - Intergenic
914160557 1:145129591-145129613 GGTAATAATACCGCATTTGCAGG + Intergenic
914655840 1:149739947-149739969 GGTAATAATACCGCATTTGCAGG - Intergenic
916483986 1:165241452-165241474 GGTTACAATACAGCCTTTGTGGG - Intronic
920092551 1:203464801-203464823 GGTAACTCCACAGCCTTTCATGG + Intergenic
920275146 1:204799001-204799023 GGTAATCATACAGCCCTTCATGG + Intergenic
921587318 1:216963515-216963537 CGTAATTCTAGAGCATTTGATGG + Intronic
923740033 1:236646575-236646597 GGTAATTAGAAAGTGTTTGAAGG - Intergenic
924624322 1:245687050-245687072 GGATATTTTGCAGCCTTTGATGG - Exonic
1064615170 10:17146075-17146097 GGTAGCAATACAGCCTTTCAGGG + Intronic
1064972492 10:21080366-21080388 GGTAAATATTCATACTTTGAGGG + Intronic
1073668152 10:105556624-105556646 GGTAATTATTCAACCTGCGAAGG + Intergenic
1074667223 10:115742047-115742069 GGTAATTATGCAGTCATTGGTGG + Intronic
1075857365 10:125641139-125641161 GCTAATTCTACAGCCTTTCTAGG - Intronic
1078483350 11:11699709-11699731 GATAATAATACAGCCTCTTAGGG - Intergenic
1079232194 11:18658426-18658448 GGTGATTAGACTGCCTTTGCAGG + Intergenic
1079315249 11:19402489-19402511 GGTAAAAATACAGACTGTGAAGG - Intronic
1082205916 11:49434110-49434132 GCAAAGTATACAGCCCTTGATGG + Intergenic
1082695617 11:56360579-56360601 GGTAATCATGCTGGCTTTGATGG + Exonic
1090656796 11:128852444-128852466 GGTAATCATTGACCCTTTGAGGG - Intronic
1093136164 12:15453914-15453936 GGTTATTATTCAGCCTTAAAAGG - Intronic
1095567943 12:43648277-43648299 GGTAATTAAACACCATTTGGAGG - Intergenic
1095817924 12:46445015-46445037 GGTCATTATAAAGCCTCTGGAGG + Intergenic
1098227761 12:68342350-68342372 AGTACTTATACAGATTTTGAAGG - Intergenic
1098561674 12:71880026-71880048 AGAAATTATACAACCATTGATGG + Intronic
1099951090 12:89304551-89304573 GTAAATTATAAAGTCTTTGAGGG - Intergenic
1100121941 12:91378719-91378741 GGCAATTATTAAGCCTTTTAAGG + Intergenic
1101664359 12:106797108-106797130 GGTAATTATTCAACCTTTTGAGG - Intronic
1104367483 12:128191205-128191227 GGTTATGCTGCAGCCTTTGAAGG + Intergenic
1107198781 13:37687890-37687912 GGTAATTTGACAGCCTGAGAAGG + Intronic
1108808770 13:54193915-54193937 AGTATTTATACAGCCTTATAAGG + Intergenic
1110017307 13:70423627-70423649 AGTATTTTTACAGCCATTGATGG + Intergenic
1110140259 13:72120614-72120636 AGTAATTATAGTGCCATTGATGG + Intergenic
1111132077 13:83990203-83990225 TGTAATAATTCAGTCTTTGAAGG + Intergenic
1115011889 14:28558728-28558750 GGCTATTATGCAGCCATTGAAGG + Intergenic
1117733196 14:58744569-58744591 GGCATTTATTCAGCCTTAGAGGG - Intergenic
1121480555 14:94267456-94267478 GGTAAACATACAGGCTTTGTTGG + Intronic
1123407368 15:20029242-20029264 GGTAATTAAAAAGACTTTGGAGG + Intergenic
1123516695 15:21035898-21035920 GGTAATTAAAAAGACTTTGGAGG + Intergenic
1126012990 15:44321043-44321065 AGTAATTATACTGCTTTAGATGG + Intronic
1128130375 15:65223356-65223378 GGAATTGATACAGTCTTTGAGGG - Intergenic
1131374377 15:91911471-91911493 GGTAATTTTACTGCCAATGAAGG + Intronic
1140837656 16:78810055-78810077 GGTAATCCTTCAGCCCTTGATGG + Intronic
1154530403 18:15338639-15338661 AGAAATTAGACAGCGTTTGAAGG - Intergenic
1163904526 19:20139986-20140008 GGTAATTATCCAGTATTTGCAGG - Intergenic
1163914022 19:20223384-20223406 GGTAATTATCCAACATTTGCAGG - Intergenic
1165232389 19:34395227-34395249 GCTAAGAGTACAGCCTTTGAGGG - Intronic
1168461615 19:56564040-56564062 GGTAATGCTAAAGCCTTTGTTGG - Intergenic
925105601 2:1288107-1288129 GGTATTTATACAGCTTAAGATGG + Intronic
926863231 2:17331168-17331190 GGTAATTCTACTTTCTTTGAGGG + Intergenic
927850738 2:26497557-26497579 GGTTATTTTTCAGACTTTGATGG - Intronic
932007807 2:67945013-67945035 GGTCACTAAACTGCCTTTGAAGG - Intergenic
933210127 2:79556996-79557018 GGAAATTCTACAGCCTTTTTGGG + Intronic
938608479 2:132921621-132921643 GGCAATCATCCCGCCTTTGAAGG + Intronic
939528307 2:143323980-143324002 GCTAATTATAAAGCATTTTAAGG - Intronic
939624072 2:144455030-144455052 GGTAACTTTGCAGCGTTTGAGGG - Intronic
940347828 2:152645853-152645875 GGTAACATTACAGCCTTTGAAGG + Intronic
944273651 2:197810453-197810475 GTTAATTACATAGCCATTGAGGG + Intronic
1169957394 20:11119782-11119804 GGTAAATATAGAACCTCTGATGG + Intergenic
1170390510 20:15868053-15868075 GATAATTATTCAGCCTTAAATGG + Intronic
1174612619 20:51810679-51810701 GGTAATTGTGCAATCTTTGAGGG - Intergenic
1176767003 21:13029800-13029822 AGAAATTAGACAGCGTTTGAAGG + Intergenic
1177163178 21:17571357-17571379 GATAATGATACAGACTTTCAAGG + Intronic
1177385569 21:20405445-20405467 GGTACTTTTACACCATTTGAAGG + Intergenic
950472901 3:13197531-13197553 GGTCATTATGCAGCCTGTGGGGG - Intergenic
951835804 3:26982378-26982400 GGTAATAATTTAGCCTCTGAGGG - Intergenic
952535573 3:34305569-34305591 GGTGATCAGACAGCCCTTGAAGG - Intergenic
953365288 3:42339425-42339447 GCCATTTATAAAGCCTTTGACGG - Intergenic
955160287 3:56458756-56458778 GGGAATGTTACAGCCTTAGAAGG + Intronic
955723988 3:61913186-61913208 GGTACTTTTTCAACCTTTGAGGG + Intronic
957373671 3:79329043-79329065 GGTAATTTTACAGATTTTGGAGG + Intronic
958196027 3:90243837-90243859 GGTCATTATTCAGCCTATTATGG + Intergenic
958881450 3:99675815-99675837 AGTATTTATTCAGCCTTAGAGGG - Intronic
961146893 3:124601708-124601730 GGTAAATATTCTGCCTTTTACGG + Intronic
961189368 3:124945070-124945092 GGTATTTAAACAGCCTTTGGAGG + Intronic
962672337 3:137721894-137721916 GGTCTTTATACTGCATTTGATGG + Intergenic
965448029 3:168800214-168800236 GTTTATTATTCACCCTTTGAAGG + Intergenic
966819862 3:183915793-183915815 GCTAATTCTACTGCCCTTGATGG - Intergenic
975346773 4:73300918-73300940 GGTATTTATCTGGCCTTTGAAGG + Intergenic
978380854 4:108127043-108127065 GGTAATTATATGGCCAATGAGGG + Intronic
979691595 4:123564687-123564709 GCTAAGTCTTCAGCCTTTGAGGG - Intergenic
980640169 4:135566679-135566701 GGTAAAAAAACAGCCTTGGACGG + Intergenic
980822212 4:138032893-138032915 GGGAAATAAATAGCCTTTGAAGG + Intergenic
983513564 4:168633907-168633929 GCTAAGTATACAGACTTTGAAGG - Intronic
983531919 4:168818806-168818828 GGTAATGATTAAGCCTATGAAGG + Intronic
983855482 4:172638643-172638665 GATAATTATACTGGCTTTGTAGG - Intronic
987862124 5:23502322-23502344 CGTAATTATTCATCCTTTGGTGG + Intergenic
990166476 5:52999373-52999395 GGTAAATGTACAGCTTTTTAGGG + Intronic
992183783 5:74224209-74224231 GGTCATTATTCAGCCTGTGACGG - Intergenic
993466805 5:88257697-88257719 AATAATTACACAGGCTTTGATGG - Intronic
993669946 5:90747921-90747943 GGGAATTAGAGAGCCTTTGAAGG + Intronic
993751560 5:91675326-91675348 GGTAATTATACAGAATCTGTTGG - Intergenic
1000129869 5:158286298-158286320 TGTAATAAAACAGCCTATGAAGG - Intergenic
1002122010 5:177012256-177012278 GTTAAATATACAGATTTTGAGGG - Intronic
1006699314 6:35958919-35958941 GGGAATTTTACAGCATTTGGAGG - Intronic
1010450596 6:75997920-75997942 GGTAATTATAAATCCTTTTCAGG + Intronic
1010964725 6:82191658-82191680 GTTAATTATACATCCTTTTCTGG - Intronic
1012938756 6:105395777-105395799 TGGATTTCTACAGCCTTTGATGG - Intronic
1015262682 6:131256469-131256491 GGAAATTATTCAACATTTGATGG - Intronic
1018424022 6:163663894-163663916 GGTCATTATAAAGACTCTGAAGG + Intergenic
1020704049 7:11520292-11520314 GTTAATTATAAATCCTTTGGAGG + Intronic
1023066613 7:36384088-36384110 TGTAAATATACAGCATTTGGAGG + Intronic
1023653723 7:42398120-42398142 GGTGATTTTTCACCCTTTGAAGG - Intergenic
1028742232 7:94288707-94288729 GGTATTTATACACCCTTGGCTGG - Intergenic
1029141991 7:98417830-98417852 GGTAGTTGCACAACCTTTGAGGG - Intergenic
1033426406 7:141248504-141248526 TGTACTTATACAGACATTGACGG + Intronic
1036731374 8:11268631-11268653 GATAATTATACAGCATTTTCGGG + Intergenic
1037460230 8:19101383-19101405 GGAAATAAAACAGCCTTTGGTGG + Intergenic
1038557182 8:28530757-28530779 GGTAATTGTACAGGCTTTTATGG - Intronic
1040081950 8:43294142-43294164 GGTACTTATACAGCTTCTTAAGG + Intergenic
1040727854 8:50404991-50405013 GAATATTATTCAGCCTTTGAAGG - Intronic
1042432462 8:68724649-68724671 GGTATATATACAGCCTATGCAGG + Intronic
1043759650 8:84051692-84051714 GGCACTTATACACACTTTGATGG - Intergenic
1044319933 8:90790973-90790995 GGTAATTATTCAATATTTGACGG - Intronic
1045710574 8:104978689-104978711 GGTGATTATTCAACCTTTGAAGG + Intronic
1046405216 8:113764054-113764076 GACAATTATACTGCCTTTGCAGG + Intergenic
1048131058 8:131698060-131698082 TGAAATTAAACAGCCATTGAAGG + Intergenic
1050458340 9:5855421-5855443 TGTGATTCAACAGCCTTTGAGGG + Intergenic
1051076286 9:13241080-13241102 TGTAAATATAGAGCCATTGAAGG - Intronic
1052485334 9:29090721-29090743 GGTAATTATATAACATTTAATGG + Intergenic
1058527085 9:105869847-105869869 GGTAATTATATACCCACTGACGG - Intergenic
1059292907 9:113243376-113243398 ATGAATTATACAGCCATTGAAGG - Intronic
1185977031 X:4733021-4733043 GACAATTATCCACCCTTTGAAGG - Intergenic
1185977747 X:4740407-4740429 GGTTATTATTCAGCCATAGAAGG + Intergenic
1186273126 X:7911573-7911595 GGTAAGTAGAGAGCCTTGGAGGG + Intronic
1186653704 X:11589926-11589948 GGTAATTATACAGCCTTTGATGG + Intronic
1187941319 X:24385297-24385319 GGAAATCATACAGCCTCAGAGGG - Intergenic
1188126936 X:26379950-26379972 AGTAATTATATGGCCCTTGAAGG + Intergenic
1190878587 X:54476748-54476770 GGGAATTATAAATCCGTTGATGG - Intronic
1191206396 X:57838043-57838065 GGAAACGATACAGACTTTGAGGG + Intergenic
1194581004 X:95670743-95670765 TGTAATTATATAGCCTTATAAGG - Intergenic
1197743812 X:129916718-129916740 TGTAAGTGAACAGCCTTTGAAGG - Intronic