ID: 1186653722

View in Genome Browser
Species Human (GRCh38)
Location X:11590105-11590127
Sequence GATTTCTTATGGTCCTGAAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186653722 Original CRISPR GATTTCTTATGGTCCTGAAT CGG Intronic
900768520 1:4521409-4521431 GAATACTAATGGTCCAGAATAGG - Intergenic
905960585 1:42039149-42039171 GATTTGTTAATGTCCTGTATTGG - Intergenic
906393241 1:45437178-45437200 GATATCTTATGCTCATGGATTGG - Intronic
907070360 1:51529023-51529045 GACTTCTTATGTTCATGAATTGG + Intergenic
908941378 1:69438669-69438691 GCTTTCTTAGGCTTCTGAATTGG + Intergenic
909584293 1:77271847-77271869 TGTTTCTTCTGGTCCTGCATTGG + Intergenic
910552423 1:88491087-88491109 GATGGCATATGGTCATGAATAGG + Intergenic
914713522 1:150235656-150235678 GATTTCTGGTGGTCCTGGGTGGG - Intronic
916503996 1:165411211-165411233 GAATCATTATGATCCTGAATTGG + Intronic
918274130 1:182935299-182935321 GATATCTTATGTTCTTGGATTGG - Intronic
921177042 1:212604719-212604741 GAGCTCTGACGGTCCTGAATGGG - Intronic
1066465964 10:35650599-35650621 TATTTCTCATGGTTCAGAATTGG + Intergenic
1068846532 10:61682574-61682596 TATTTCTTATGATGCTAAATTGG + Intronic
1070559213 10:77553294-77553316 TATTTCAAATGTTCCTGAATTGG + Intronic
1070992471 10:80744579-80744601 CATTTCTTGGGGTCCTCAATGGG - Intergenic
1078445212 11:11399105-11399127 GAATTCATGTGGTCATGAATGGG + Intronic
1081056978 11:38421866-38421888 TATTTCTTAGGGACCAGAATAGG + Intergenic
1084843810 11:71883113-71883135 GATATCCTATGTTCATGAATTGG + Intronic
1086307011 11:85491767-85491789 GATATCCTATGTTCATGAATTGG + Intronic
1086315519 11:85587868-85587890 CATTTCTTGTGGTGCTGACTTGG + Intronic
1086852739 11:91829892-91829914 GATATCCTATGGTCATGGATTGG + Intergenic
1087172276 11:95061400-95061422 GATTCCTTTTGGTTCTGCATTGG - Intergenic
1087207076 11:95408155-95408177 GATTGCTTATGGGACTAAATAGG + Intergenic
1088014985 11:105047501-105047523 GTTTACTTATGCTCCTGAATTGG - Intronic
1088017068 11:105073710-105073732 GTTTACTTATGCTCCTGAATTGG - Intronic
1088017123 11:105074411-105074433 ATTTACTTATGCTCCTGAATTGG - Intronic
1088019618 11:105103622-105103644 GTTTATTTATGCTCCTGAATTGG - Intergenic
1091083757 11:132698985-132699007 GATATCTCATGTTCCTGAATTGG - Intronic
1093360037 12:18213785-18213807 GATATCCTATGTTCATGAATTGG + Intronic
1094265330 12:28552407-28552429 CATTTCATATGGTGCTGAGTTGG + Intronic
1095765944 12:45895965-45895987 GATTTCTCATGTTCATGGATTGG + Intronic
1096603211 12:52745384-52745406 TATTTATTTTGTTCCTGAATAGG - Intergenic
1097181544 12:57174796-57174818 CATCTCTTTTGGTCTTGAATGGG - Intronic
1098586658 12:72162477-72162499 GATTTATTATCTTCCTGCATTGG + Intronic
1101734014 12:107449275-107449297 TATTTCTTATGTTCGTGAACAGG + Intronic
1104700778 12:130902578-130902600 GATTTCTGTTGGCCCTGAATAGG + Intergenic
1107453217 13:40531223-40531245 AAAAACTTATGGTCCTGAATTGG + Intergenic
1109615008 13:64822172-64822194 GATATCTGATGTTCATGAATTGG + Intergenic
1111223070 13:85230756-85230778 AAATTCATATGGTCCAGAATGGG + Intergenic
1117678202 14:58176724-58176746 GATTTTTTATGTTCCTGAGAAGG + Intronic
1117825652 14:59700252-59700274 GATTTCTTATGTTCATGAATTGG + Intronic
1121966830 14:98315232-98315254 TATTTACTATGTTCCTGAATGGG - Intergenic
1123015615 14:105373099-105373121 GATGTCATATGTTCATGAATTGG + Intronic
1124469620 15:29971570-29971592 TATTGCTTATTATCCTGAATAGG - Intergenic
1130036567 15:80366708-80366730 GATTTCATTTGGTCCTAAAATGG - Intronic
1130611826 15:85368138-85368160 GATTTCTTATGAATCTTAATGGG - Intergenic
1133487608 16:6235313-6235335 GACTTTTTATGCTGCTGAATAGG - Intronic
1135827367 16:25741126-25741148 GATTTGTTAAAGTCCTGCATGGG - Intronic
1141308397 16:82888678-82888700 AGTTTCTTCTGTTCCTGAATGGG + Intronic
1144319823 17:14103924-14103946 GATTCTTTCTGGTCCTGAAAAGG + Intronic
1146913896 17:36665852-36665874 GAATTGTTTTGGTACTGAATAGG - Intergenic
1150783786 17:68145973-68145995 TATTTCTTCTGATCCTGAACTGG - Intergenic
1155355651 18:24950735-24950757 GATTTCTTAAGGTCCTAGTTGGG + Intergenic
1156438890 18:37164394-37164416 GAGTTCTTATGGTGATCAATTGG + Intronic
1156810152 18:41239604-41239626 GATATCTCATGTTCATGAATTGG - Intergenic
1165699324 19:37925511-37925533 GATCTCTTAGGGTCCTGCACAGG + Intronic
1168017408 19:53584525-53584547 GATATTTCATGGTCCTGAATTGG + Intergenic
927831914 2:26358664-26358686 GATTTCTTCTGATCCTGGCTTGG - Intronic
928961072 2:36926594-36926616 TGTTTCTTGTGGTACTGAATAGG - Intronic
930377088 2:50581741-50581763 GATGTCTTATTGTCCAGAACAGG - Intronic
935030774 2:99319758-99319780 AATTTCTTTTGGTTCTGAAATGG + Exonic
938374058 2:130793572-130793594 GACATCTTATGTTCGTGAATTGG - Intergenic
939241706 2:139569593-139569615 GATATCTTATGCTCATGGATTGG + Intergenic
939335860 2:140827006-140827028 GAACACTTCTGGTCCTGAATTGG - Intronic
940772885 2:157857713-157857735 GATTTCTTACGGTGCTGACAAGG - Intronic
941255179 2:163220300-163220322 GATTTTTTAAGGTAGTGAATAGG - Intergenic
942622529 2:177862704-177862726 GATATCCTATGCTCCTGGATTGG + Intronic
943055397 2:182971417-182971439 GATATCTCATGTTCATGAATTGG + Intronic
943294801 2:186124214-186124236 GATTTCTTACGGTTCTGTTTAGG - Intergenic
944145923 2:196507444-196507466 TATTTCTGATGGTCATGACTGGG + Intronic
1171187663 20:23134414-23134436 GATTTCCTTTGTTCATGAATTGG + Intergenic
1173355624 20:42286101-42286123 GATATCTCATGGTCATGGATTGG + Intronic
1181168702 22:20996526-20996548 GTTTTCTTTGGATCCTGAATGGG + Intronic
957493770 3:80964221-80964243 TTTTTCTTATGGGCCTCAATGGG + Intergenic
958003456 3:87781624-87781646 GATATCTCATGCTCATGAATTGG + Intergenic
958692297 3:97483347-97483369 GACTGCATATAGTCCTGAATAGG - Intronic
961718813 3:128878611-128878633 GCTGTCTTCTGTTCCTGAATGGG - Intergenic
961908747 3:130291362-130291384 CTTTTCTTATGTTGCTGAATTGG + Intergenic
964235019 3:154515303-154515325 GATATCTTATGTTCATGGATTGG - Intergenic
965710245 3:171549699-171549721 GATTTCATAATGTCCTGAAAAGG - Intergenic
968040497 3:195585029-195585051 AATTTCTTATGTTTCTGAAAAGG - Intergenic
968386576 4:144628-144650 GATATTTTATGTTCATGAATAGG - Intronic
969784899 4:9449205-9449227 GATATCCTATGTTCATGAATTGG + Intronic
976422687 4:84864482-84864504 GATTTCTTTTGTTCATGGATTGG - Intronic
977899295 4:102400164-102400186 GATATCTCATGTTCTTGAATGGG + Intronic
978415479 4:108471090-108471112 GATTTTTAATGTTCATGAATAGG + Intergenic
978428436 4:108606262-108606284 AATTTAATATGTTCCTGAATTGG + Intergenic
982371610 4:154639348-154639370 GAGTTCACATGGACCTGAATAGG + Intronic
983729294 4:170973468-170973490 GATGTCTTATGCTCTTGGATTGG - Intergenic
983762966 4:171437031-171437053 GATGTAGTATGGTCATGAATTGG + Intergenic
985859482 5:2459335-2459357 GAGTTCTAATGGACCTAAATTGG - Intergenic
986067231 5:4246389-4246411 GATTCCTTTTGGTCGTGAACAGG - Intergenic
988198004 5:28031406-28031428 GACTTCTTATGGGTCTGATTAGG - Intergenic
989611247 5:43294101-43294123 GTTTTCTTATGGTTCTGGTTTGG - Exonic
990320373 5:54624114-54624136 GATCTCTTAAGATGCTGAATGGG - Intergenic
990442060 5:55856486-55856508 AATTTCTTATGGCCCAGATTTGG + Intronic
991903502 5:71483983-71484005 GATTTGTTTTGTTCCTGTATTGG + Intronic
994228999 5:97291349-97291371 GATATTTTATGTTCATGAATTGG - Intergenic
995271545 5:110225449-110225471 AAGTTATTCTGGTCCTGAATGGG - Intergenic
995620209 5:114017670-114017692 GTTTTCTATTGTTCCTGAATAGG + Intergenic
995620417 5:114020190-114020212 TTTTTATTATGGTCCTGAAGAGG + Intergenic
1003617151 6:7665772-7665794 GCATTCCTATGATCCTGAATTGG - Intergenic
1004198367 6:13525815-13525837 GATTCCTTTTTGTCCTGCATGGG - Intergenic
1007139589 6:39557518-39557540 GTTTTAGTATGTTCCTGAATGGG + Intronic
1011424583 6:87212873-87212895 TATTTCTTATGGATCTGAAATGG - Intronic
1017254056 6:152313389-152313411 GACTTCGTAGGGGCCTGAATAGG - Intronic
1020685824 7:11293291-11293313 GATTTCTTATTGTCTTTAAGAGG + Intergenic
1022151069 7:27607166-27607188 GACATCTTATGGTCTTTAATTGG - Intronic
1022188272 7:27990618-27990640 GATTAATTATGGTATTGAATAGG - Intronic
1026044686 7:66898818-66898840 TCTTTCTTATGGTTCTCAATAGG - Intergenic
1027998491 7:85459332-85459354 GATTTCTTATAATCATGATTTGG - Intergenic
1028153379 7:87401767-87401789 ATGGTCTTATGGTCCTGAATGGG - Intronic
1028881242 7:95882416-95882438 TATTTCTTAAAGTCCTGGATAGG + Intronic
1029853584 7:103490133-103490155 GATTTATTATGGACTAGAATAGG - Intronic
1030430181 7:109435615-109435637 CATCTGTTCTGGTCCTGAATTGG + Intergenic
1033512166 7:142069825-142069847 GATATCTTCTGGTAGTGAATGGG - Intronic
1036287241 8:7453997-7454019 GATTTCTTAAAGTACTGAGTTGG - Intronic
1036334240 8:7857527-7857549 GATTTCTTAAAGTACTGAGTTGG + Intronic
1036828900 8:12004974-12004996 GATATCCTATGTTCGTGAATTGG - Intergenic
1036834133 8:12044924-12044946 GATATCCTATGTTCGTGAATTGG - Intergenic
1036837406 8:12085494-12085516 GATTTCTCATGCTCATGAGTTGG + Intergenic
1036855977 8:12291489-12291511 GATATCCTATGTTCGTGAATTGG - Intergenic
1036859197 8:12331738-12331760 GATTTCTCATGCTCATGAGTTGG + Intergenic
1041385427 8:57297422-57297444 AATTTCCTATGATCCTCAATAGG + Intergenic
1042971189 8:74410803-74410825 GTGTTCTTATGGCCCTGTATTGG + Intronic
1043012641 8:74900293-74900315 ACTTTCTTATTATCCTGAATGGG - Intergenic
1043979572 8:86622559-86622581 GATTGCTTCTGGTGGTGAATGGG - Intronic
1046428287 8:114085129-114085151 GATTTCTTATTTGCCTGTATGGG + Intergenic
1048419010 8:134258635-134258657 GAGTTCTAATGGTTCTCAATTGG - Intergenic
1048642037 8:136374637-136374659 TATTTCTTTTGGTCTTGAAAAGG + Intergenic
1049393791 8:142387050-142387072 GGTTTCTTATGTTCCTAATTTGG - Intronic
1050009144 9:1168204-1168226 AATTTCTTATTTTCCTGAATGGG - Intergenic
1050438645 9:5636175-5636197 GATATCTTATGTTCATGGATTGG - Intronic
1051088227 9:13376934-13376956 GATTTCCTCTGCCCCTGAATTGG + Intergenic
1051179710 9:14397618-14397640 GACTTCATATGGTCTTGAATAGG - Intronic
1051732388 9:20158554-20158576 TATTTCTTATTGTTCTGGATGGG - Intergenic
1054959702 9:70954222-70954244 GATGTTTTATTGTCCTGAACAGG - Intronic
1059119631 9:111630683-111630705 GATTTTTTATTGTCATGACTGGG + Intergenic
1186653722 X:11590105-11590127 GATTTCTTATGGTCCTGAATCGG + Intronic
1190055895 X:47180771-47180793 GGGTTTTTATTGTCCTGAATAGG + Intronic
1191227693 X:58062138-58062160 TTTTTCTTATGGGCCTCAATCGG + Intergenic
1191586385 X:62831546-62831568 GATATCTTGTGATCATGAATTGG + Intergenic
1191952915 X:66614081-66614103 TATATCTTATGGTCCAGAACTGG - Intronic
1192855593 X:75007248-75007270 GATATTTTATGTTCATGAATTGG - Intergenic
1193723027 X:85008872-85008894 GATATCCTATGTTCATGAATTGG - Intronic
1194529876 X:95033388-95033410 GAGTTCTCATGGTAATGAATGGG - Intergenic
1197397839 X:125949308-125949330 TTTTTCTGGTGGTCCTGAATAGG + Intergenic
1199006524 X:142704917-142704939 TATTTCTTATGATCCTTGATTGG - Intergenic
1201516024 Y:14819424-14819446 GTTTTCAGATAGTCCTGAATAGG - Intronic