ID: 1186654469

View in Genome Browser
Species Human (GRCh38)
Location X:11598027-11598049
Sequence CCAAGACCTGTGGCAGTCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 151}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186654469_1186654476 15 Left 1186654469 X:11598027-11598049 CCTAAGACTGCCACAGGTCTTGG 0: 1
1: 0
2: 0
3: 13
4: 151
Right 1186654476 X:11598065-11598087 GACACTGGAGAGAGGAAAACTGG 0: 1
1: 0
2: 5
3: 45
4: 445
1186654469_1186654475 7 Left 1186654469 X:11598027-11598049 CCTAAGACTGCCACAGGTCTTGG 0: 1
1: 0
2: 0
3: 13
4: 151
Right 1186654475 X:11598057-11598079 TCACATGGGACACTGGAGAGAGG 0: 1
1: 1
2: 0
3: 20
4: 232
1186654469_1186654474 0 Left 1186654469 X:11598027-11598049 CCTAAGACTGCCACAGGTCTTGG 0: 1
1: 0
2: 0
3: 13
4: 151
Right 1186654474 X:11598050-11598072 TGTGATCTCACATGGGACACTGG 0: 1
1: 0
2: 0
3: 19
4: 255
1186654469_1186654473 -7 Left 1186654469 X:11598027-11598049 CCTAAGACTGCCACAGGTCTTGG 0: 1
1: 0
2: 0
3: 13
4: 151
Right 1186654473 X:11598043-11598065 GTCTTGGTGTGATCTCACATGGG 0: 1
1: 0
2: 0
3: 18
4: 144
1186654469_1186654472 -8 Left 1186654469 X:11598027-11598049 CCTAAGACTGCCACAGGTCTTGG 0: 1
1: 0
2: 0
3: 13
4: 151
Right 1186654472 X:11598042-11598064 GGTCTTGGTGTGATCTCACATGG 0: 1
1: 0
2: 0
3: 19
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186654469 Original CRISPR CCAAGACCTGTGGCAGTCTT AGG (reversed) Intronic
902693518 1:18125363-18125385 CCAGGACCTGTGCCAGACTCAGG - Intronic
904969535 1:34408303-34408325 CCAAGACTCGTGACATTCTTGGG + Intergenic
905334369 1:37234068-37234090 CCAAGAGCTCTGGCAGGCTTGGG - Intergenic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
907962879 1:59298922-59298944 CCCAGAACTGTGGTAGTCTCTGG + Intronic
909128583 1:71707157-71707179 CCAACCCCTGTGGCAGTGTAGGG - Intronic
912850082 1:113116151-113116173 CCAAGAGCTGTTGCGGTCCTAGG + Intronic
912861169 1:113215162-113215184 CCAGTGCCTGAGGCAGTCTTAGG - Intergenic
916506880 1:165436214-165436236 CCATGACCTGTGGCTGTTTGTGG + Intronic
917000250 1:170349853-170349875 TCAAGAACTGTGAGAGTCTTAGG - Intergenic
920299671 1:204980918-204980940 CTAAGACCAGAGGGAGTCTTTGG - Intronic
921346210 1:214188095-214188117 CTGAGACCTGTGGCAGTGTCTGG - Intergenic
922603131 1:226871749-226871771 CCAAGACCTTTGGCGGTAATTGG + Intronic
923022684 1:230177045-230177067 CCAAGAGATGGGGGAGTCTTAGG + Intronic
924136675 1:240974033-240974055 AGAAGACTTGTGGCAGGCTTGGG + Intronic
1063546061 10:6983129-6983151 CCAAAACCTTTGGAATTCTTTGG - Intergenic
1064619809 10:17203342-17203364 CAAAAACCTGTGGCAGTGTTGGG - Intergenic
1066197787 10:33117951-33117973 CTAAACCCTGTGCCAGTCTTGGG + Intergenic
1072208033 10:93221626-93221648 CCCAGACTTGTGGCAGTGCTAGG - Intergenic
1075713291 10:124542140-124542162 CCAGCACCTGGGGCAGTCTGGGG + Intronic
1077680941 11:4239337-4239359 CTAAGAACTGTGGCAGTAGTTGG - Intergenic
1077685229 11:4284778-4284800 CTAAGAACTGTGGCAGTAGTCGG - Intergenic
1077689959 11:4333151-4333173 CTAAGAACTGTGGCAGTAGTTGG + Intergenic
1077793530 11:5466862-5466884 CCAAAACCTGTGGCGTTCTGGGG - Intronic
1080657368 11:34268490-34268512 CCAAAACCTCAGGCAGTCATTGG + Intronic
1080941682 11:36925489-36925511 CTAGGAATTGTGGCAGTCTTAGG - Intergenic
1081027421 11:38032975-38032997 CCAAGACCTTTGGGAGGCTGAGG + Intergenic
1081197958 11:40184556-40184578 CAAGCATCTGTGGCAGTCTTGGG + Intronic
1083872638 11:65498519-65498541 GCAAAACGTGTGGCTGTCTTGGG + Intergenic
1084118450 11:67055432-67055454 CCGAGCCCTGTGGCAGTTTCGGG + Intergenic
1084774860 11:71368554-71368576 CCAAGACCTGTGCCTGGCTTGGG - Intergenic
1085717717 11:78887977-78887999 CCAAGAGCTGTGCCAGTGGTTGG + Intronic
1091540403 12:1455556-1455578 CCAAGCCCTGTTGCCGTCTGTGG + Intronic
1091703338 12:2678231-2678253 TCAAGACTTCTGGCATTCTTTGG + Intronic
1093656161 12:21696244-21696266 ACAGGGACTGTGGCAGTCTTTGG + Intronic
1094717190 12:33024401-33024423 CCAAGAGCTGGGGCATTGTTAGG + Intergenic
1096612685 12:52813507-52813529 CCAGCACCTGTGGCAGGCTCAGG + Intronic
1097747640 12:63317527-63317549 CCAAGCCCCAGGGCAGTCTTGGG - Intergenic
1098041924 12:66361441-66361463 TTAAGATCTGTGGCAGACTTAGG + Intronic
1099592788 12:84617393-84617415 CCAAGACATGTGGCAATTGTGGG - Intergenic
1103927951 12:124434086-124434108 CCAGGAGATGTGGCAGGCTTGGG + Intronic
1103942252 12:124507564-124507586 CCATGCCCTGTGGCCGTCATGGG - Intronic
1107724106 13:43280312-43280334 CAAAGACCTGTGGCCCTCTTTGG + Intronic
1111742732 13:92224961-92224983 CCAAGCCTGGAGGCAGTCTTGGG + Intronic
1113353532 13:109553764-109553786 CCAAGCTCTGTGGCAGTGGTGGG + Intergenic
1114651047 14:24284745-24284767 CCAAGGCCTTTGGCGGTCGTGGG + Intergenic
1116640731 14:47459245-47459267 CCAGGACCTATGCCAGCCTTCGG - Intronic
1118311598 14:64697613-64697635 CCCAGGCCTGTGGCTGTCTTAGG - Intergenic
1118640046 14:67783470-67783492 CGATGACCTGTGGCACACTTAGG + Exonic
1122806074 14:104258057-104258079 CTAACATCTGTGTCAGTCTTGGG - Intergenic
1123807281 15:23888089-23888111 CCAAGACCTGAAGCAGCCTGAGG - Intergenic
1125351516 15:38772292-38772314 CCAACACCTATGGCTGTGTTTGG - Intergenic
1132761209 16:1509404-1509426 CCAAGAGCTCTGGCAGTGTGCGG + Intronic
1132973983 16:2702495-2702517 CCCTGGCCTGGGGCAGTCTTGGG + Intronic
1133112536 16:3557170-3557192 CCAACACCTGAGACAGTCGTGGG - Intronic
1133396258 16:5449856-5449878 CCAAGACCTTTGGGAGGCTGAGG - Intergenic
1137389668 16:48070878-48070900 CCAAGCCCTCTGGCAGGCATTGG + Intergenic
1137912807 16:52395301-52395323 CCAACCCCTATTGCAGTCTTGGG - Intergenic
1139703779 16:68726302-68726324 CCCTGACCTGTGGCTGTCATGGG + Intergenic
1141336560 16:83160974-83160996 TCAAGATCTGTGACTGTCTTGGG - Intronic
1142174976 16:88640951-88640973 CCCAGGCCTGTGACAGTCTCAGG + Intergenic
1143074883 17:4333010-4333032 CCAGGACCTGTGACAGTCTCTGG + Intronic
1143740985 17:8953866-8953888 CCAAGGACTGTGGCAGCCCTAGG - Intronic
1146499682 17:33353718-33353740 CCAAGACCTATGGGACTCCTAGG - Intronic
1146580353 17:34031842-34031864 CCAAGACTTATGGCAGTATGTGG + Intronic
1147637109 17:41970846-41970868 TCCACACCTGTGGCTGTCTTTGG - Intronic
1149292176 17:55227931-55227953 CCAGGAGCTGTGGCAGCCATTGG - Intergenic
1151196638 17:72436308-72436330 CCTAGCCCTGTGGGAGGCTTAGG - Intergenic
1152161463 17:78671056-78671078 CCAGGACAAGGGGCAGTCTTGGG + Intergenic
1153730513 18:8006723-8006745 CAAAGAACTGTGGCAGTGTTTGG - Intronic
1153976477 18:10272430-10272452 CCCAGAGCTCTGGCATTCTTGGG + Intergenic
1154083137 18:11277544-11277566 CCAAGACCTCTGGGAGTCTAAGG + Intergenic
1161031762 19:2061066-2061088 CCAGGACCTGTGACAGTCCGGGG - Intergenic
1161935300 19:7368304-7368326 CCTAGACCTGGGGGAGCCTTGGG - Intronic
1164617329 19:29674892-29674914 CCAAGACCTGTGGGTGTTCTGGG - Exonic
925419482 2:3700516-3700538 TCATGACCTGTTGCAGTTTTGGG - Intronic
927152772 2:20205293-20205315 GCATGACCTGTTGCCGTCTTGGG + Intronic
927238378 2:20898927-20898949 TCAAGTCCTGGGGCATTCTTGGG + Intergenic
929699609 2:44150706-44150728 CAGAGACCTGTGGCAGCCGTGGG - Intergenic
931240995 2:60452604-60452626 TCAAGATGTGTGGCAGTTTTCGG - Intronic
932126991 2:69153478-69153500 CCAAGACTTGTGCCTGTCCTGGG - Intronic
932185691 2:69693604-69693626 CCCTGACATGTGGCAGTCCTTGG - Intronic
933230192 2:79798054-79798076 CCAAGACCTGCAGCATTCTCTGG + Intronic
936890833 2:117367574-117367596 CCAAGACCTGTGGGAATTTAGGG + Intergenic
937523486 2:122739224-122739246 CCAACACCAGTTGCAGTCCTAGG - Intergenic
938956015 2:136299018-136299040 CCAAGACCTCTGTCTGTCCTGGG - Intergenic
946063206 2:216963238-216963260 CCAAGACATGTGGAAATCGTGGG - Intergenic
946352483 2:219164376-219164398 CAAAGACCTGGGACAGTCTGAGG - Intronic
946738174 2:222775277-222775299 CCAACACCTGAGGCAGTATCTGG + Intergenic
947497596 2:230649572-230649594 CCATGGCCTGTGGCAGACTCTGG + Intergenic
947670825 2:231934389-231934411 CCACCACCTGTGGCCGTTTTCGG + Intergenic
1170266802 20:14475862-14475884 CCAAGACCTTTCAGAGTCTTGGG + Intronic
1172613319 20:36267317-36267339 CGAAGGCCTGTGTCTGTCTTAGG - Intronic
1172851570 20:37970135-37970157 CCAAGCCCTGTGCTAGTCATTGG - Intergenic
1173732201 20:45336807-45336829 CCCTGACCTGAGGCTGTCTTAGG - Intronic
1173875119 20:46365439-46365461 CCAAGACCTTGGGCAGTGATGGG - Intergenic
1173906052 20:46630156-46630178 CAAAGAACTGTGACCGTCTTGGG - Intronic
1174472379 20:50770447-50770469 ACAAGTCCTGTGGCCGTGTTGGG + Intergenic
1175408476 20:58750808-58750830 CCATGACCTGTGGGAGTTGTGGG - Intergenic
1178030196 21:28517141-28517163 CACACACCTGGGGCAGTCTTGGG + Intergenic
1181047409 22:20222125-20222147 CCAAGCCCTGTGGCACACTGGGG - Intergenic
1181542992 22:23583924-23583946 CCGAGACCTGGGGCTGTCCTTGG - Intergenic
1184850817 22:47119195-47119217 CCAAGACTTTTGGCAATGTTTGG - Intronic
1185421103 22:50734825-50734847 CCAAGACCTGTGGACAACTTTGG + Intergenic
949652177 3:6172511-6172533 CCTAGAGTTGTGGCAGTTTTTGG + Intergenic
950221813 3:11201889-11201911 CCCAGGCCTGTGGCAGTGTTGGG + Intronic
951126611 3:18992175-18992197 CAAAGATCTGTGGCTGTCATGGG + Intergenic
952160208 3:30685783-30685805 CCAACACCTGTGGCAGCTGTAGG + Intronic
956475865 3:69619586-69619608 CCAAGAACTGAGGGATTCTTAGG + Intergenic
963037923 3:141048503-141048525 CCAAGATCTGTAGCATTCGTGGG - Intergenic
963661563 3:148133395-148133417 CCAAGAACTGTGGGAGGCTGAGG + Intergenic
967580151 3:191143442-191143464 CTCAGACCTGTGCAAGTCTTGGG + Intergenic
970432319 4:16000754-16000776 CCAAGCCCTGTGTCACTCCTAGG - Intronic
975724697 4:77280492-77280514 CCAGGACCTGTTGCAGGCTCAGG - Intronic
975861880 4:78686144-78686166 CCCATATCTGTGGCTGTCTTTGG - Intergenic
978752771 4:112271161-112271183 CCAAGACCTGTGTCAGACTGTGG - Intergenic
979067044 4:116150626-116150648 CCAATACCTTTGCCAGCCTTTGG + Intergenic
980392925 4:132169663-132169685 ACAGCACCTGTGGCAGTCTGCGG - Intergenic
981353639 4:143761875-143761897 ACAACACCTGTGGCAATATTGGG - Intergenic
988735976 5:34021751-34021773 CCAGGACCTGTGGCAGGGTGAGG + Intronic
989468615 5:41787660-41787682 CCTAGACCTGTGTTAGTTTTGGG - Intronic
989966720 5:50473967-50473989 CCATGACCTGTGGGAGTTATGGG - Intergenic
990398654 5:55412811-55412833 CAAAGACATTTCGCAGTCTTGGG + Intronic
991418052 5:66411866-66411888 CCAATACCCGGGGCAGTTTTTGG + Intergenic
992752318 5:79872619-79872641 CCAAGTTCTGGGTCAGTCTTAGG + Intergenic
995397810 5:111706541-111706563 CCAAGAGCTGCTGCAATCTTAGG + Intronic
997409590 5:133680945-133680967 CCCAGACCTGTGGGATTCTGGGG + Intergenic
998037999 5:138932831-138932853 CCAAGTCCTGTCCCAGTCTCTGG + Intronic
999340088 5:150762841-150762863 GCAAGACCTGTGTCATTGTTAGG + Intergenic
1000521122 5:162295882-162295904 CCAAGACCTGTGTGTGTCATGGG - Intergenic
1002499269 5:179636870-179636892 CCAAGACCTCTGACTTTCTTTGG + Intergenic
1002502407 5:179655651-179655673 CCAAGACCTCTGACTTTCTTTGG - Intergenic
1006779369 6:36621708-36621730 CGAGGTCCTGTGGCCGTCTTGGG + Intergenic
1006986766 6:38180607-38180629 CCAAGAGGTATTGCAGTCTTGGG - Intronic
1013461520 6:110378941-110378963 ACACCACCTGTGGCAGTCTGCGG + Intergenic
1015067600 6:129050308-129050330 TGAAGGCCTGTGGCAGTCATTGG + Intronic
1015346086 6:132161423-132161445 CCAAGACCTTTGGCAATGTCTGG + Intergenic
1020744383 7:12063770-12063792 CCAACACCTGATGCAGCCTTTGG + Intergenic
1022089382 7:27097531-27097553 CCAAGAATTGATGCAGTCTTGGG + Intergenic
1022474594 7:30701655-30701677 CCAAGTCCTGGGGCAGGATTTGG + Intronic
1026054246 7:66970852-66970874 GCCAGCCCTGTGGCAGTCTTCGG + Intergenic
1026219505 7:68381313-68381335 GCAAGACTTGGGGCAGTCTTTGG - Intergenic
1027242146 7:76337919-76337941 CCAAGCCTGGAGGCAGTCTTGGG + Intronic
1028442512 7:90880301-90880323 CTACCACCTGTGGCAGTCTGTGG + Intronic
1029546959 7:101215750-101215772 CCAAGACTTTTGGGAGGCTTAGG - Intronic
1034158660 7:148976263-148976285 CCCAGACCTGCGCCAGGCTTTGG + Intergenic
1034690056 7:153007023-153007045 ATAGGACCTGTGGCAGTCCTGGG - Intergenic
1035082517 7:156229028-156229050 CCAAGACATATGTCAGGCTTTGG - Intergenic
1036756286 8:11473335-11473357 CCGAGACATGAGGCAGGCTTTGG + Intronic
1039571431 8:38589677-38589699 CCATGGCCTGTGGGAGTCTTGGG + Intergenic
1045053256 8:98345708-98345730 CCAACATCTGTGTCAGTCTGGGG - Intergenic
1048904193 8:139071864-139071886 CCCAGACCTTTGGGAGTCTGAGG + Intergenic
1049490435 8:142897232-142897254 CCCAGAACTGTGGGAGGCTTAGG - Intronic
1058810572 9:108634886-108634908 TCAAGAACTGTGGCATTTTTGGG - Intergenic
1060994681 9:127869268-127869290 CCTAAAGCTGTGGCAGTCATGGG - Intronic
1062305352 9:135903410-135903432 CCAAGAATTGTGGCCGCCTTGGG - Intronic
1186654469 X:11598027-11598049 CCAAGACCTGTGGCAGTCTTAGG - Intronic
1186782209 X:12924425-12924447 TCAAGAACTGTGGCAGTCCCAGG - Intergenic
1187897101 X:23992164-23992186 TCATGAGCTGTGGCAATCTTGGG + Intronic
1200114505 X:153764309-153764331 GCAAGAGCTGGGGCAGGCTTGGG + Intronic
1200362055 X:155617475-155617497 CAAAGAGCTAAGGCAGTCTTGGG - Intronic
1202160235 Y:21926348-21926370 CCTAGAACTTTGGCAGTCTGAGG + Intergenic
1202231121 Y:22660034-22660056 CCTAGAACTTTGGCAGTCTGAGG - Intergenic
1202312037 Y:23536131-23536153 CCTAGAACTTTGGCAGTCTGAGG + Intergenic
1202558766 Y:26134463-26134485 CCTAGAACTTTGGCAGTCTGAGG - Intergenic