ID: 1186654763

View in Genome Browser
Species Human (GRCh38)
Location X:11600778-11600800
Sequence TTCCCAGGAAACACCAGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 4, 2: 13, 3: 72, 4: 302}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186654757_1186654763 22 Left 1186654757 X:11600733-11600755 CCCAGTGGGCAAGCATATGAGTG 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1186654763 X:11600778-11600800 TTCCCAGGAAACACCAGTAGGGG 0: 1
1: 4
2: 13
3: 72
4: 302
1186654758_1186654763 21 Left 1186654758 X:11600734-11600756 CCAGTGGGCAAGCATATGAGTGT 0: 1
1: 0
2: 1
3: 9
4: 92
Right 1186654763 X:11600778-11600800 TTCCCAGGAAACACCAGTAGGGG 0: 1
1: 4
2: 13
3: 72
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186654763 Original CRISPR TTCCCAGGAAACACCAGTAG GGG Intronic
900962914 1:5937118-5937140 TTCCGAGGAAACCCCAGGTGTGG - Intronic
900962947 1:5937229-5937251 TCCCCAGGAAACCCCAGGTGTGG - Intronic
901169395 1:7245829-7245851 ATCCCAGGAAACACCAGTCAGGG + Intronic
901446844 1:9313711-9313733 TTCCCAGGAAGCTGCAGCAGGGG + Intronic
901822671 1:11840237-11840259 TCCCCAGGCAGCACCAGGAGAGG - Exonic
902041896 1:13498741-13498763 ACCCCAGGAAACACCTGCAGGGG - Intronic
902163611 1:14552232-14552254 TTCCCAGGATACATTAATAGGGG - Intergenic
903265254 1:22154213-22154235 GTGCCAGGAAACCCCAGCAGGGG - Intergenic
903690320 1:25168699-25168721 TTGCAAGTAAACACCACTAGAGG - Intergenic
903740100 1:25553823-25553845 TTCCTAGGAAACCCCAGCAAGGG - Intronic
904635511 1:31877867-31877889 AGTACAGGAAACACCAGTAGAGG - Intergenic
904984263 1:34531971-34531993 GGCCCCAGAAACACCAGTAGAGG + Intergenic
905518766 1:38581481-38581503 GTGCCAGGAAACACAAGCAGAGG - Intergenic
906045786 1:42830065-42830087 AACCAAGGAAACACCAGTAATGG - Intronic
906772258 1:48495632-48495654 ATCCCAGGAAACACCAATTAGGG + Intergenic
907845689 1:58204471-58204493 TTCCCCAGAAGCACCAGTAGGGG + Intronic
907872416 1:58455134-58455156 ATCCCAGGAAACACCTGCAGGGG + Intronic
908332005 1:63080567-63080589 GTCCCAGGGAACACTAGTAAGGG + Intergenic
908596133 1:65690616-65690638 TTCTCAGGAAACACTAATATGGG + Intergenic
909522782 1:76588597-76588619 ATCACAGGAAACACCATTTGGGG + Intronic
909965537 1:81904959-81904981 TTCCCATCAAACTCAAGTAGAGG - Intronic
910754612 1:90674207-90674229 TTCCAAGGAAAAACCAGTAAAGG + Intergenic
912499369 1:110111915-110111937 ATCCCAGGAGGCACCAGGAGGGG - Intergenic
912954535 1:114145375-114145397 TTCCCAGGTCACACAACTAGTGG + Intronic
913508864 1:119544390-119544412 TCCACAGGAAACACCAGTGCAGG + Intergenic
916378651 1:164184168-164184190 ATACCAGGAAACACCAATAATGG + Intergenic
917646007 1:177029479-177029501 TTAGGAGGAAACACCAGTTGTGG + Intronic
919471202 1:197980812-197980834 ATTCCAGGAGACACCAGTAAGGG - Intergenic
919675711 1:200380585-200380607 TTCCCTGGAAATAGTAGTAGAGG - Intergenic
920370453 1:205475714-205475736 ATCCCAGGATATACCAGGAGTGG - Intergenic
921134097 1:212244814-212244836 TTCCCAGGAAAAAACAGTAGGGG - Intergenic
922594942 1:226806434-226806456 TTGCAAGGAAACACGAGGAGAGG - Intergenic
922702178 1:227768240-227768262 TTTCCAGGAATCAACTGTAGGGG - Intronic
923386929 1:233473992-233474014 TTGTGAGTAAACACCAGTAGAGG + Intergenic
1064849529 10:19695299-19695321 TCCCCAGGCACCACCAGTAATGG - Intronic
1065701724 10:28432310-28432332 TTCTCTTGAAACACCAGTAGAGG + Intergenic
1065753479 10:28909876-28909898 TTCCCAGGAAAATTCAGAAGGGG - Intergenic
1067036508 10:42924594-42924616 TGCCAAGGAACCACCAGAAGCGG - Intergenic
1067721084 10:48728204-48728226 ATCCCAGAAAACACCAGTAGGGG - Intronic
1067786671 10:49255227-49255249 CTCCCAGGAGAAACCAGTGGGGG - Intergenic
1069728231 10:70594861-70594883 ATCCCAGGAGGCACCAGCAGGGG - Intergenic
1070509993 10:77152415-77152437 ATCTCAGGAAACACCAGTAAGGG + Intronic
1072201718 10:93166070-93166092 ATCCCAGGAAACACCTGCAAGGG + Intergenic
1072768288 10:98114461-98114483 ATCCCAAGAAGTACCAGTAGAGG + Intergenic
1073179577 10:101575542-101575564 TTCCCAGGCATCACCTGGAGTGG - Intronic
1073485923 10:103819266-103819288 TTCCCAGGGAACCCCAGGAGAGG + Intronic
1074371164 10:112901694-112901716 ATCCCAGGAAGCACCAGTAAGGG - Intergenic
1075099560 10:119496519-119496541 TTCCAAAGAAACCACAGTAGAGG + Intergenic
1076081639 10:127586893-127586915 ATCCCAGGAAAAACTGGTAGAGG - Intergenic
1076360009 10:129881540-129881562 TTCTCAGGAACCAGCAGAAGGGG + Intronic
1076624501 10:131813081-131813103 GTTCCAGGAAACAGCAGTGGGGG - Intergenic
1077249360 11:1554228-1554250 TTCCCAGCAAATAACAGGAGGGG + Exonic
1077592725 11:3505177-3505199 ATTCCAGGGAACACCAATAGGGG + Intergenic
1078353369 11:10614117-10614139 TTCCAAGAAAACCCCAGTAAAGG + Intronic
1078526199 11:12103490-12103512 ACCCCAGGAAGCACCAGTAAGGG + Intronic
1078889206 11:15538876-15538898 ATCCCAGGAAATACTAGTAAAGG - Intergenic
1079351272 11:19694147-19694169 CTCCCAGGACAAACCAGTAAAGG + Intronic
1079987165 11:27211574-27211596 TTCCCTGGCAACACCACAAGGGG - Intergenic
1081103743 11:39038045-39038067 TTCTAGGGAAACACCAGTAATGG + Intergenic
1081155612 11:39685849-39685871 TTTGCGGGAAACACCAATAGTGG + Intergenic
1081524236 11:43913926-43913948 TTCCCTGGAAAACCCAGAAGAGG + Intronic
1083000919 11:59289900-59289922 GTCCCAGGAAACAGCAGTCGGGG - Intergenic
1084248555 11:67877897-67877919 ATTCCAGGGAACACCAATAGGGG + Intergenic
1084297880 11:68225007-68225029 ATCCCAGGAAGCACCAGTTGGGG + Intergenic
1084824269 11:71717579-71717601 ATTCCAGGGAACACCAATAGGGG - Intergenic
1087729254 11:101759944-101759966 GCCCCAGGAAGCACCAGTAGGGG + Intronic
1088432342 11:109772702-109772724 TTCACAGGAAACACAAAAAGTGG + Intergenic
1088683074 11:112261040-112261062 TTCCCAGGAAAGACCTGAGGAGG + Intronic
1088717536 11:112561835-112561857 ATCCCAGGAAACATCAGCAGTGG - Intergenic
1089817711 11:121191072-121191094 TTCACATGAAAAACCAGTAAAGG + Exonic
1090439618 11:126714749-126714771 ATCCCAGGAAACCCTGGTAGGGG - Intronic
1092418837 12:8313298-8313320 ATTCCAGGGAACACCAATAGAGG + Intergenic
1093326277 12:17778724-17778746 ATCCCAGAAATCACTAGTAGAGG - Intergenic
1093860250 12:24156342-24156364 CTCCCAGGAGAAACCAGTAAAGG - Intergenic
1094818521 12:34208068-34208090 TACCCATGAAACACCAGCCGTGG - Intergenic
1095797135 12:46232256-46232278 ATACCAGGTAACACCAGTATAGG + Intronic
1095798499 12:46246863-46246885 TGCCCAGGTATCACCAGTGGAGG - Intronic
1095802658 12:46284325-46284347 TGCCCAGGTATCACCAGCAGAGG - Intergenic
1097517051 12:60618585-60618607 CACCCAGGTATCACCAGTAGAGG - Intergenic
1101206784 12:102496241-102496263 TTACCATTAAACACCAGTGGTGG + Intergenic
1101722523 12:107362451-107362473 GTGGCAGGAAACATCAGTAGAGG + Intronic
1102297542 12:111748518-111748540 TCCCCAGGAAACACCACTGAGGG + Intronic
1102405802 12:112673112-112673134 TTTCCAGGAAGCACCTGGAGAGG - Intronic
1102414661 12:112750305-112750327 GTCCCAGGAAACACTAGGAGGGG + Intronic
1103024680 12:117563905-117563927 ATCCCAGGCCACACCAATAGAGG - Intronic
1103303559 12:119946476-119946498 ATCCCAGGAAACAACAGTGTGGG - Intergenic
1103554122 12:121755669-121755691 ATCCCAGGAGACACTGGTAGTGG + Intronic
1103609675 12:122115285-122115307 TTCTAAAGAAAAACCAGTAGTGG + Intronic
1103944820 12:124520145-124520167 TCCCCAGGAAACACCCCTGGGGG + Intronic
1104240319 12:126982931-126982953 TTACCAACAAACACCAGTACAGG - Intergenic
1105255341 13:18740779-18740801 ATCCCAGGAAACACCAGTAGAGG + Intergenic
1106866555 13:33970613-33970635 ATTCCAGGAAACACCAGTAGGGG + Intergenic
1108957288 13:56175677-56175699 TTCCTAGAAAACACCAATAAAGG - Intergenic
1114499157 14:23155238-23155260 TTCCAAGGACACACCAGCAGAGG + Intronic
1114563495 14:23610426-23610448 CTCCCAGGAGAAACCAGTAAGGG - Intergenic
1114613064 14:24054615-24054637 ATCCCAGGAAAAACCAGGAGTGG - Intronic
1117090975 14:52249982-52250004 TTCCCCGAAAACAACAGTAATGG + Intergenic
1117609093 14:57464072-57464094 ATGCCACGAAATACCAGTAGAGG - Intergenic
1119774009 14:77237422-77237444 ATCCCAGGAAAGGCCAGTAAGGG + Intronic
1120487234 14:85129478-85129500 TTCCCAGGAAACTTCAGTTCAGG + Intergenic
1120813196 14:88825688-88825710 CTCCAAGGCAACACCACTAGAGG - Intronic
1121259915 14:92558603-92558625 ACCCCAGGAAGCACCAGTAGGGG + Intronic
1121413825 14:93765074-93765096 ATCCCAGAAAACACCAAAAGGGG - Intronic
1121467145 14:94123267-94123289 ATCCCAGGAAACACCAACAGGGG + Intergenic
1121585991 14:95063428-95063450 ATTCCAGGAAATACCAGTAGAGG + Intergenic
1121745685 14:96288960-96288982 TTCCCCTGAAACACCACTATGGG - Intronic
1122574325 14:102732158-102732180 ATCCCAGGCAACAGAAGTAGGGG - Intergenic
1127702962 15:61518925-61518947 ATCCCCGGAAGCACTAGTAGGGG - Intergenic
1132201224 15:99956091-99956113 TTCCCATGGAACCACAGTAGAGG - Intergenic
1132532152 16:457457-457479 TTCCCTGCAAAATCCAGTAGTGG - Intronic
1133009148 16:2900718-2900740 TTCCCAGGCAACAGCAGGAGGGG - Intergenic
1133322539 16:4923199-4923221 TTCCCAGGTAGAACCAGTGGAGG - Intronic
1134362037 16:13540586-13540608 ATCCCAGGAAAAATCAGTAGGGG - Intergenic
1134784928 16:16933798-16933820 ATCCCAGGAAGCACCAGTAAGGG + Intergenic
1134852864 16:17495982-17496004 ATCTCAGGAAGCACCAGAAGAGG + Intergenic
1135863639 16:26080494-26080516 ATCCCAGGAAACACAAATAGAGG + Intronic
1135967479 16:27048011-27048033 ATCCCAGGAAACACCAATATGGG - Intergenic
1136250225 16:28999607-28999629 GTCCCAGAAAACACTGGTAGGGG + Intergenic
1137246822 16:46712518-46712540 ACCCCAGGAAACCCCAATAGAGG - Intronic
1137695093 16:50456273-50456295 GTCCCAGGAAACGCCAGCAAAGG + Intergenic
1137827950 16:51515943-51515965 ATCTCAGGAGACACCAGTAGAGG - Intergenic
1137906722 16:52331130-52331152 CTCCGAGGAAACACCAATATGGG - Intergenic
1138160529 16:54749040-54749062 ATCCCAGGAAGCACCTGTAGAGG + Intergenic
1138216608 16:55210357-55210379 GTCCCAGGAAGTACCAGCAGGGG + Intergenic
1138512267 16:57515520-57515542 TTCCCAGGGAACAGCAGGAGTGG - Intronic
1138594175 16:58020832-58020854 TTCCCAGAAACTGCCAGTAGAGG + Exonic
1141215105 16:82016451-82016473 ATCCCAGAAACTACCAGTAGGGG + Intergenic
1141466967 16:84212690-84212712 ATCCCGGGAAACACTAGTAGGGG - Intergenic
1141826703 16:86485690-86485712 TTCACAGGACCCACAAGTAGAGG - Intergenic
1141868209 16:86765689-86765711 ATCCCAGGAAACACCAACAGGGG + Intergenic
1141893652 16:86944732-86944754 TTCCCAAGAAACACACGCAGGGG + Intergenic
1141950477 16:87336099-87336121 TCCCCAGCACACACCAGGAGAGG + Intronic
1143323366 17:6082267-6082289 ATCCCAGGGAACACTAGTGGGGG + Intronic
1143543379 17:7582573-7582595 TTCCCAGGAGCCCCCAGTGGAGG - Intergenic
1144145026 17:12389115-12389137 TGGCCAGGAAACACCATTAAGGG + Intergenic
1144654277 17:17025378-17025400 GTCCCAGGAAACACCAATAGAGG + Intergenic
1144958550 17:19032065-19032087 TTCCCAGGAAACACCGGTGCTGG + Intronic
1144976610 17:19142459-19142481 TTCCCAGGAAACACCGGTGCTGG - Intronic
1146562873 17:33886778-33886800 TTCCCTTGAAACAGCAGTATTGG + Intronic
1146593214 17:34146665-34146687 TTCCCAGGTATCTCCAGAAGAGG + Intronic
1147316515 17:39623440-39623462 GTCCCAGGAAACACCCTTAGAGG - Intergenic
1147905938 17:43823093-43823115 GCCCCAGGAAATACCAGTACAGG - Intronic
1150245503 17:63671716-63671738 TTCTCAGGAGAAACCAGTGGAGG - Intronic
1150974083 17:70064252-70064274 TCCCCAGGAAAGACCAGGGGTGG + Intronic
1153574910 18:6510753-6510775 AACCCAGGAAACACTGGTAGGGG + Intergenic
1154435676 18:14339823-14339845 ATCCCAGGAAACACCAGTAGAGG - Intergenic
1155269611 18:24127287-24127309 GTTCCAGAAAACAGCAGTAGTGG + Intronic
1156933572 18:42675366-42675388 TCCAGAGGCAACACCAGTAGTGG - Intergenic
1157908768 18:51595521-51595543 ATCCCAGGAAACAGCAGTAAAGG + Intergenic
1158024044 18:52874878-52874900 TCCCAAAGAAACACCAGTAAAGG - Intronic
1158076607 18:53537127-53537149 CTCCCAGGAGAAACCATTAGGGG - Intergenic
1158559618 18:58503038-58503060 ATCCCAGGAAACGCCAGTAGAGG - Intronic
1158827711 18:61242344-61242366 CTCCCAGGAAAAGCCAGTAAGGG + Intergenic
1159366704 18:67475566-67475588 TTCCCAAGAAACATCAGGACTGG - Intergenic
1160841768 19:1149568-1149590 TCCCCAGGAGATACCAGCAGGGG - Intronic
1162541659 19:11300236-11300258 ATCCCAGAAAACACCTGCAGGGG + Intronic
1162834131 19:13305072-13305094 ATCTCAGGAAGCACCAGTAGGGG + Intronic
1162849592 19:13420572-13420594 TTGCCAGGAGCCACCAGAAGAGG + Intronic
1163763841 19:19151485-19151507 TTCCCAGGAACCTCGAGTGGGGG - Intronic
1164454447 19:28395621-28395643 ATCCCAGGAAACACAGGTAAGGG + Intergenic
1164792129 19:30996347-30996369 ACCCCAGGAAGCACCAGTAGGGG + Intergenic
1164802808 19:31091754-31091776 TGCCCAGGAACCACCAGCACTGG + Intergenic
1164887715 19:31797167-31797189 ATCCCAGAAAACAACTGTAGGGG + Intergenic
1166255019 19:41597753-41597775 TTCCCAGGACTGACCACTAGAGG - Intronic
925121191 2:1419665-1419687 TTCCCAGGAAACACGTTTTGAGG - Intronic
926216606 2:10909490-10909512 CCCCCAGGAAACCCCAATAGAGG + Intergenic
926652239 2:15359031-15359053 TTCTCAGGAAACTCCTGTGGAGG - Intronic
928260414 2:29761621-29761643 TTCCCAGCAGACAGCAGAAGAGG - Intronic
928285674 2:29988091-29988113 ATTCCAGGAAGCAGCAGTAGGGG - Intergenic
929174830 2:38966085-38966107 ATCCCAGGCAAGACCAGAAGGGG + Exonic
929874808 2:45787536-45787558 TTCCCATGAAACACCTGTTTAGG - Intronic
930277902 2:49334960-49334982 TTTCAAGGAAACACCAGTTTAGG - Intergenic
930305117 2:49666926-49666948 TGGCCAGAAAACACCAGCAGGGG + Intergenic
930342448 2:50134051-50134073 TTCCCAGGAAATACAAGAATAGG - Intronic
930869093 2:56151730-56151752 ATCCCAGGAAACATCAGCATGGG + Intergenic
931651091 2:64469451-64469473 ATCCCAGGCAACAGTAGTAGGGG - Intergenic
931986114 2:67744269-67744291 TTCCCGGGTATCACCAGCAGAGG + Intergenic
932405021 2:71507006-71507028 TGCTCAGGAAACCCCAGAAGGGG + Intronic
932871515 2:75404141-75404163 TTCTCAGGATAAACCAGTAGAGG - Intergenic
934042203 2:88136869-88136891 GGACCAGGAAAGACCAGTAGGGG - Intergenic
934490358 2:94758321-94758343 ATCCCAGGAAACACCAGTAGAGG + Intergenic
935310120 2:101775320-101775342 TTCACAGGAAATACAAGCAGAGG - Intronic
936071465 2:109374372-109374394 GTCCCAGGAAACACCTGTTCAGG - Intronic
937868160 2:126769273-126769295 TTCCCCAGAACCACCGGTAGGGG - Intergenic
938278285 2:130047526-130047548 ATTGCAGGCAACACCAGTAGAGG + Intergenic
938329257 2:130438331-130438353 ATTGCAGGCAACACCAGTAGAGG + Intergenic
938360689 2:130683162-130683184 ATTGCAGGCAACACCAGTAGAGG - Intergenic
938437091 2:131289860-131289882 ATTGCAGGCAACACCAGTAGAGG - Intronic
940934492 2:159475849-159475871 TTCCTAGGTATCACCAGTGGAGG + Intronic
941848072 2:170151176-170151198 ATCCCAGGAAGCATCAGGAGAGG - Intergenic
942916369 2:181312655-181312677 GTGACAGGAAACACTAGTAGAGG - Intergenic
942974113 2:181993990-181994012 TTCCCAAAAAACAGTAGTAGTGG + Intronic
943648918 2:190436103-190436125 TTCCCTGGAAATACCATTAAAGG - Exonic
943709517 2:191075321-191075343 TTCCCACTAAAAACAAGTAGAGG - Intronic
947545522 2:231007816-231007838 ATCCCAGCAAACACCAATAGGGG + Intronic
947690632 2:232132898-232132920 TACCCAGAAAACACCAGGAAAGG + Intronic
947825691 2:233104856-233104878 CTCCCAGGAGAAACCAGTAAGGG + Intronic
948208328 2:236174489-236174511 TTCCCAGGAGAGAACAGGAGGGG + Intergenic
948799629 2:240426214-240426236 GTCCCAGGAAACAGCAGCAGGGG + Intergenic
1169322080 20:4641139-4641161 TTCCCAGAACACAAAAGTAGGGG + Intergenic
1169448400 20:5691124-5691146 TTCCCAGGAATCAACAGTAAGGG + Intergenic
1169669762 20:8083621-8083643 ATCTCAGGAAACACTAGTAGTGG - Intergenic
1169788151 20:9382607-9382629 CACCCAGGAAACACCAGTCCAGG - Intronic
1170018958 20:11814204-11814226 ATGTCAGAAAACACCAGTAGAGG - Intergenic
1170209418 20:13833863-13833885 GTCCCAGGAAACACCAGCCTTGG + Intergenic
1170264567 20:14451084-14451106 GTCCCAGGAAGCACTGGTAGAGG + Intronic
1170580710 20:17697646-17697668 ATCCCAGGAAACATAGGTAGGGG + Intronic
1170586365 20:17737296-17737318 ATGCCAGGAAACACTGGTAGTGG - Intergenic
1170723487 20:18904393-18904415 ATCCCAGAAACCACCACTAGAGG - Intergenic
1170766965 20:19298544-19298566 ATCCCAGGAAACAACAGTAGAGG + Intronic
1170784493 20:19455759-19455781 ATCCGAGGAAGCACCAGTAAGGG - Intronic
1170968318 20:21096057-21096079 ATCTCTGGAAACACCAGTAAGGG - Intergenic
1171443991 20:25190668-25190690 ACACCAGGAAAAACCAGTAGAGG + Intergenic
1171880154 20:30612732-30612754 ATCCCAGGAAACACCAGAAGAGG + Intergenic
1172280357 20:33703595-33703617 GTCCCAGGAAGCACTGGTAGGGG + Exonic
1172312610 20:33930064-33930086 ATCCCAGGAAGTACCAGTAGGGG - Intergenic
1172462806 20:35132989-35133011 GTCCTTGTAAACACCAGTAGAGG + Intronic
1172846515 20:37932686-37932708 ATCCCAGGAAACACAAGTAGGGG - Intronic
1172944982 20:38680332-38680354 TATCCAGGCAAGACCAGTAGAGG + Intergenic
1172956755 20:38765473-38765495 TTCAGAGGAAACACCTGGAGTGG + Exonic
1173177839 20:40777861-40777883 GTCCCAGGAAGCACCAGTAGGGG + Intergenic
1173338930 20:42136788-42136810 ATCCCAGGAAACACCAGCAGGGG + Intronic
1173894389 20:46539295-46539317 ATTCCTGGAAGCACCAGTAGGGG - Intergenic
1173947474 20:46963171-46963193 ATCCTGAGAAACACCAGTAGGGG - Intronic
1173995502 20:47335345-47335367 TTCCCAGGAAAGCCCAGGATAGG + Intronic
1174140932 20:48413124-48413146 GTCCCAGGAAATACCAACAGGGG - Intergenic
1174324595 20:49769117-49769139 ATCCCAGAAAGCACCATTAGGGG + Intergenic
1174664076 20:52240851-52240873 ATCCCAGGAAACACCCATAAAGG + Intergenic
1174769097 20:53281705-53281727 CTCCCAGGAAGAACCAGTAAGGG + Intronic
1174783694 20:53413045-53413067 ATCCCAGGAACCCCCAATAGGGG + Intronic
1175322585 20:58099857-58099879 ATCCCAGGCAACTCCAGCAGGGG - Intergenic
1175499779 20:59441608-59441630 ATCCTAGGAAACACTAGGAGAGG + Intergenic
1175696254 20:61105414-61105436 ATCCCAGGAAACTGCAGCAGTGG + Intergenic
1176841357 21:13845809-13845831 ATCCCAGGAAACACCAGTAGAGG + Intergenic
1177498835 21:21924186-21924208 TTGCCAGCAACCACCAGAAGAGG + Intergenic
1177707595 21:24728001-24728023 AATCCAGGAATCACCAGTAGGGG - Intergenic
1178048454 21:28722563-28722585 TTCCCAGGAATAACCAGCACAGG - Intergenic
1180842975 22:18967856-18967878 TTCCTAGGAAGCCCCAGCAGGGG - Intergenic
1180933044 22:19606251-19606273 TCCTCAGGAAACACCAGCCGTGG - Intergenic
1181758669 22:25042796-25042818 ATCCCAGGAAGAACCAGTAGGGG + Intronic
1182776721 22:32836930-32836952 TTCCCAGAATGCACCAGGAGTGG - Intronic
1183047107 22:35229042-35229064 ATCCAAGGAAACTCCAGGAGGGG + Intergenic
1183277000 22:36904809-36904831 TTCCCAGGTAAGACCCATAGAGG + Intergenic
1184843124 22:47064089-47064111 TTCACAGGAACCACCAGGACCGG + Intronic
1185097273 22:48817619-48817641 TTCCCAGGAAGGACCCATAGGGG + Intronic
949377757 3:3408403-3408425 TTCCCGGGTATCACCAGTGGAGG - Intergenic
949585450 3:5432348-5432370 ATCCTAGAAAACACCAGTAGGGG - Intergenic
949903286 3:8837677-8837699 TTCCCAGGAAACCAAAATAGAGG - Intronic
951473601 3:23081700-23081722 ATCCTAGGAACCACCAGAAGGGG - Intergenic
951744079 3:25957475-25957497 ATCCCAGGAAGCATCAGAAGGGG - Intergenic
952106644 3:30077729-30077751 ACCCCAGGAGGCACCAGTAGGGG - Intergenic
952240033 3:31521942-31521964 CTCTCAGGAAATATCAGTAGGGG - Intergenic
952308545 3:32167133-32167155 TTCCTAGGGAACACAATTAGAGG - Exonic
953324097 3:41998109-41998131 ATCCCAGGAAACACCGGCAGGGG + Intergenic
953376658 3:42434390-42434412 TTCTCAGGATCCAACAGTAGTGG + Intergenic
953461255 3:43082863-43082885 ATCCCATGAAACACGTGTAGGGG + Intronic
953558714 3:43967684-43967706 ATCCCAGGAAACATCAGGAGTGG - Intergenic
953698614 3:45179256-45179278 TTCCCAGGACAGCCCAGTAAGGG + Intergenic
955536565 3:59929944-59929966 ATCCCTGGAAACACGAGTAAGGG + Intronic
955541772 3:59984278-59984300 GGCCCAGGAAGCACCATTAGGGG + Intronic
955858338 3:63298729-63298751 GTCCCAGGAAACACTGGTAAGGG + Intronic
955905799 3:63806326-63806348 ATCCCAGGAAACACCCAGAGTGG - Intergenic
956738932 3:72259794-72259816 ACCCCAGGAAACACTAGAAGGGG - Intergenic
957062805 3:75495851-75495873 ATTCCAGGGAACACCAATAGGGG + Intergenic
959957239 3:112252608-112252630 TGACCAGAAAACACCAGCAGGGG - Intronic
961290593 3:125843565-125843587 ATTCCAGGGAACACCAATAGGGG - Intergenic
961896519 3:130172520-130172542 ATTCCAGGGAACACCAATAGGGG + Intergenic
962158905 3:132978388-132978410 TTATCAGGAAAAAACAGTAGAGG + Intergenic
962921438 3:139953801-139953823 GTCTCAGGAAATACCAGTAGGGG - Intronic
964380435 3:156093750-156093772 TTCCCAAGAATCAACAGCAGTGG + Intronic
964395433 3:156240826-156240848 GGCACAGGAAACACCAGTAGGGG + Intronic
964487553 3:157201371-157201393 TTCCTAGGAAAGACCAGCCGTGG - Intergenic
965361242 3:167741175-167741197 TTCCCAGGCAGAACCAGAAGGGG - Intronic
966259541 3:177959187-177959209 TTCCCAGGAAACAATTGTAATGG + Intergenic
967034523 3:185638276-185638298 TTTCCAGGAAACCCAAGTACTGG - Intergenic
968145209 3:196292824-196292846 ATTCCAGGAAACATTAGTAGAGG - Intronic
968425284 4:519141-519163 TTCCCAGGAAGGAAAAGTAGAGG - Intronic
968554912 4:1241979-1242001 TTCCCAGGAGCCACCGGGAGAGG + Intronic
969006704 4:4025985-4026007 ATTCCAGGGAACACCAATAGGGG + Intergenic
969394430 4:6910864-6910886 TGCCCAGGGACCTCCAGTAGGGG - Intronic
969806278 4:9611434-9611456 ATTCCAGGGAACACCAATAGGGG - Intergenic
970594625 4:17588937-17588959 TTCCCAACAAACACCAGGGGTGG - Exonic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
972840871 4:42928704-42928726 TCCCATGGAAACACCAGTAAAGG - Intronic
973789293 4:54363721-54363743 ATCCCAGGAAGCAGAAGTAGAGG + Intergenic
977236841 4:94517992-94518014 TTCCAAGGAAACGCAAATAGAGG + Intronic
977330819 4:95635130-95635152 ATCCCAAGAAACACAAGTACTGG - Intergenic
978610190 4:110529437-110529459 TTTCCAGGAAAGATCAGTGGGGG + Intronic
980639272 4:135553746-135553768 TTCCTTAGAAACTCCAGTAGTGG + Intergenic
981072377 4:140557308-140557330 ATCCCAGGAAACACTGGTAAAGG + Intergenic
981199751 4:141966530-141966552 TTCCTAGGTATCACCAGTGGAGG - Intergenic
984224503 4:177018042-177018064 TGCCCAGGTATCACCAGTGGAGG - Intergenic
986667240 5:10114364-10114386 CTCCCAGGAGACACCAAGAGGGG - Intergenic
988386289 5:30569636-30569658 ATTCCAGGAAACACAGGTAGTGG + Intergenic
989090965 5:37730958-37730980 TTCCCAGAGAAAATCAGTAGGGG + Intronic
993413865 5:87601927-87601949 TCGGCAAGAAACACCAGTAGGGG + Intergenic
993870062 5:93242044-93242066 TTCCCAGGAATGAACACTAGTGG - Intergenic
994079347 5:95689200-95689222 TTACCAGGAAACAGCAGAAAGGG - Intronic
994658834 5:102628685-102628707 ATCCCAGGAAACAGCAGCAAGGG - Intergenic
995870493 5:116738810-116738832 ATCCCAGGAAATAGCAGTAGGGG - Intergenic
999972524 5:156879122-156879144 TTCTCAGGAGTCACCAGTAGTGG - Intergenic
1001705224 5:173736690-173736712 TTACCAGGAAGAACAAGTAGAGG - Intergenic
1002074392 5:176699461-176699483 ATCCCAGGAACCGCCAGTGGCGG + Intergenic
1002374554 5:178779078-178779100 CTCCAAGCAAACACCATTAGTGG - Intergenic
1004278954 6:14264253-14264275 TGCCCAGCAAACAGCAGGAGTGG - Intergenic
1005858239 6:29880549-29880571 TTCTCAGGAAACACCATGAGGGG - Intergenic
1006574812 6:35037449-35037471 ATCCCAGGAAGCACTGGTAGGGG + Intronic
1006832232 6:36975963-36975985 CTCCCAGAAAACACCAGTAGAGG - Intronic
1007176219 6:39899417-39899439 CTTCCAGAAAACACCAGTAGAGG + Intronic
1007410766 6:41660044-41660066 GTTCCAGGAAACACCAGTAGGGG + Intergenic
1007712224 6:43831739-43831761 TTTCCATAAAACACCAGTAAAGG + Intergenic
1009492147 6:64304060-64304082 TCTCCAGTAAACACCACTAGAGG - Intronic
1011174193 6:84541647-84541669 TTCCCAGGTATCACCAGCTGAGG - Intergenic
1014070468 6:117175706-117175728 TGCCCAGGTATCACCAGCAGAGG - Intergenic
1020327207 7:6984130-6984152 ATTCCAGGGAACACCAATAGGGG + Intergenic
1020722511 7:11765670-11765692 TTCCCAGGAAATCCAAGCAGGGG - Intronic
1021249446 7:18306042-18306064 ATCCCAGGAAACTCCAATAGGGG + Intronic
1023352008 7:39329753-39329775 CTCCCAAGAAAAACCAGGAGGGG - Intronic
1023924601 7:44657261-44657283 TTGCCAGGGAATACAAGTAGTGG - Intronic
1024324095 7:48095350-48095372 TGCCCAGGTAACCCCAGCAGAGG - Intronic
1024922682 7:54576078-54576100 GTTTCAGGAACCACCAGTAGAGG + Intergenic
1026488237 7:70839007-70839029 TTCCCAGGTATCACCAGTGGAGG - Intergenic
1030432621 7:109469968-109469990 TTCCCAGGAAAACCTGGTAGGGG - Intergenic
1031971150 7:128065976-128065998 TTCCCAGGAAAAACCCGTGCTGG - Intronic
1032911055 7:136430717-136430739 TTTCCAGAAAACAGAAGTAGAGG - Intergenic
1033050590 7:138000976-138000998 TTCGGAGGAAAAACCAGCAGAGG - Intronic
1033219525 7:139519101-139519123 ATCCCAGGAAGCATCAGGAGAGG + Intergenic
1033843171 7:145399868-145399890 TTCTCAAGAAACACCAGAAGTGG - Intergenic
1034584397 7:152076387-152076409 ATCCCAGGACACACCAGTAGGGG + Intronic
1035837331 8:2768529-2768551 GTCCCAGGAAATCCAAGTAGAGG - Intergenic
1036126814 8:6070448-6070470 TTCCCAGGAAATAAAAGCAGAGG - Intergenic
1037507920 8:19550996-19551018 TTCCCAGCAATCACCAGTTTTGG + Intronic
1042051328 8:64711400-64711422 TTCCCAGGAAGCAGCGGTGGTGG - Intronic
1042395368 8:68285841-68285863 CTACCAGGCAACACCAGCAGGGG - Intergenic
1043269239 8:78308666-78308688 TTTCCAGGAAACACGAGTTCAGG + Intergenic
1043311487 8:78865066-78865088 TTCCCGGGTAAAACCAGTAAAGG - Intergenic
1043941148 8:86197337-86197359 TTGCCAGGAAACAGCAGCAAGGG + Intergenic
1044264594 8:90166816-90166838 AGCCCAGAAAACACCAGTAGGGG - Intergenic
1044269230 8:90221422-90221444 TTGGGAGGAAACACTAGTAGGGG + Intergenic
1044822438 8:96163428-96163450 TCCCCAGGAAACAACACTTGTGG + Intergenic
1045060063 8:98403397-98403419 ATCCCAGGAAGCCCCAGCAGGGG + Intronic
1047174938 8:122531433-122531455 ATCCCAGGAAACACCACGAGTGG + Intergenic
1047556743 8:125940233-125940255 ATCCCAAGAAACATCAGTAGGGG - Intergenic
1048438361 8:134439282-134439304 ATCCCAGGAAATACTAGTAGGGG - Intergenic
1048653796 8:136512352-136512374 TTCCCAGGAGACATCAGTAATGG - Intergenic
1048680698 8:136838337-136838359 ATCCTAAGAAACACCAGTAGGGG - Intergenic
1049238196 8:141523212-141523234 TTCCCAGGAAACTGGAGCAGGGG - Intergenic
1049956342 9:696435-696457 TTCCCAGGACAGAGCAGTTGAGG + Intronic
1050334008 9:4573494-4573516 TTCCCAGGTATCAGCAATAGAGG - Intronic
1051722479 9:20052683-20052705 ATCCCAGGAAACAGCAGTCAGGG - Intergenic
1052673429 9:31587693-31587715 TTCCCAGGAGAAAACAGTAAGGG - Intergenic
1053667648 9:40327383-40327405 ATCCCAGGAAACATCAGTGGAGG - Intronic
1053917225 9:42952492-42952514 ATCCCAGGAAACATCAGTGGAGG - Intergenic
1054378789 9:64467422-64467444 ATCCCAGGAAACATCAGTGGAGG - Intergenic
1054516963 9:66048900-66048922 ATCCCAGGAAACATCAGTGGAGG + Intergenic
1056189767 9:84173280-84173302 TTCCCAAGAAGCACCACTAGGGG - Intergenic
1056306157 9:85292511-85292533 ATCCCAGGAAACTCCAGAAGGGG - Intergenic
1056306835 9:85298899-85298921 ATCTCAGGAAACACCAGCAGGGG + Intergenic
1056315106 9:85380720-85380742 TCCCAAGGAAACTCCAGTAAAGG + Intergenic
1057061065 9:92004145-92004167 ATCCCAGGAAACGCCTGTAGGGG - Intergenic
1057256616 9:93554367-93554389 TTCCTAAGAAACACCTGCAGGGG + Intronic
1057754722 9:97823147-97823169 ACCCTAGGAAGCACCAGTAGGGG + Intergenic
1058512376 9:105733502-105733524 TTCCAAGGAAACACAGCTAGAGG - Intronic
1058528026 9:105879389-105879411 ATTCCAGGAAACAGCAGGAGGGG - Intergenic
1058544907 9:106050916-106050938 ATCCCAGGAAATTCCAATAGGGG - Intergenic
1059757925 9:117311040-117311062 GTCCCAGGGAGCCCCAGTAGGGG - Intronic
1062723887 9:138060387-138060409 TTCCCAGTAGAAACCAGCAGAGG + Intronic
1186551053 X:10506344-10506366 TTGCCAGAAAACACCAGTACTGG + Intronic
1186615791 X:11186917-11186939 GTCCTGGGAAACACCTGTAGGGG + Intronic
1186654763 X:11600778-11600800 TTCCCAGGAAACACCAGTAGGGG + Intronic
1187222312 X:17340166-17340188 ATCCCAGGAAAGACTGGTAGAGG + Intergenic
1187275583 X:17814082-17814104 ATCCCAGACAACACCAGTAGAGG + Intronic
1187570020 X:20491302-20491324 ATCCCAAGAAGCATCAGTAGGGG - Intergenic
1187682989 X:21786667-21786689 ATCCTAGGAGATACCAGTAGCGG - Intergenic
1187727015 X:22213926-22213948 GTACAAGGAAACACCAGTAGGGG + Intronic
1187740933 X:22354743-22354765 TTCCCAGGAAATTTCAGTAGAGG - Intergenic
1187830961 X:23380604-23380626 AGCCCAGGAAGCACCAGTATGGG + Intronic
1189241219 X:39526150-39526172 ATCCTAGGAAGCACCGGTAGGGG - Intergenic
1189263445 X:39694650-39694672 ATCCCAGGAAACACTGATAGGGG - Intergenic
1189264085 X:39700296-39700318 ATTCCAGAAGACACCAGTAGAGG + Intergenic
1189552041 X:42103039-42103061 ATCCCAGAAAACACCAGTAAAGG - Intergenic
1189592547 X:42530374-42530396 TTCCCAGGAAAAAACACTAAGGG - Intergenic
1189682114 X:43527493-43527515 TTCCCAGGAGAGAGCAGTAAGGG + Intergenic
1189839183 X:45053932-45053954 TTCCGAGGAAATACCAGGACTGG - Exonic
1189966723 X:46381291-46381313 TCCTCAGGAAACACCAGTTAGGG + Intergenic
1194937437 X:99968482-99968504 TTCCCAGAAAACAAAAGTTGAGG - Intergenic
1195148539 X:102043058-102043080 TGGCCAGAAAACACCAGTGGAGG - Intergenic
1195727842 X:107935956-107935978 ATCCCAGGAGACACCAGGTGGGG - Intergenic
1197916201 X:131538606-131538628 TTCTCTGGAAAGGCCAGTAGTGG + Intergenic
1198038924 X:132830034-132830056 TTCATAGAAAACACCAGTGGTGG - Intronic
1198176752 X:134164023-134164045 TTGCCAGTAACCACCAGAAGGGG + Intergenic
1201692975 Y:16789670-16789692 TGCCCAGGTATCACCAGTGGAGG - Intergenic