ID: 1186654917

View in Genome Browser
Species Human (GRCh38)
Location X:11601992-11602014
Sequence CTGTGTGTATGGAGGTGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 856
Summary {0: 1, 1: 0, 2: 4, 3: 60, 4: 791}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186654913_1186654917 9 Left 1186654913 X:11601960-11601982 CCTACAGTGCAGTTTTGCTAGTC 0: 1
1: 0
2: 0
3: 11
4: 69
Right 1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG 0: 1
1: 0
2: 4
3: 60
4: 791

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186654917 Original CRISPR CTGTGTGTATGGAGGTGAGA GGG Intronic
900733121 1:4276030-4276052 CGGCGTATCTGGAGGTGAGAAGG + Intergenic
900748331 1:4376804-4376826 CTGTGTGTGTCCAGCTGAGACGG + Intergenic
901008981 1:6187908-6187930 CTGTGTGTTGGGTGGTGAGCAGG - Intronic
901032874 1:6318483-6318505 CTTTGTGCACGGAGGTAAGAAGG - Exonic
901210860 1:7525274-7525296 GTGTGTGTAGGGGGGTGAGATGG - Intronic
901716953 1:11163038-11163060 GTGTGTGTCTGCACGTGAGATGG - Intronic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
901927060 1:12573022-12573044 CTGTGTGCCTGGAGGAGTGAGGG - Intronic
902122890 1:14182984-14183006 CTGTGGGTATGGAACTGAGAGGG - Intergenic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903830294 1:26170395-26170417 CTGTAGGAATGGAAGTGAGAAGG - Intronic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
904687685 1:32272758-32272780 CTGTGTGTGTGGGGGTGTGTGGG + Intronic
904954278 1:34269976-34269998 CTTTGTGTGGGGAGGAGAGAAGG + Intergenic
905246362 1:36617087-36617109 CTGTGTCTATGGGTGTGAGACGG + Intergenic
905597875 1:39224179-39224201 ATGTGTGTATGGGGGGGAGTAGG - Intronic
905784513 1:40743448-40743470 TTGTCTTTATGGAGGTGAGTTGG + Intronic
906554794 1:46701001-46701023 GTGTGTGTGTGCATGTGAGATGG + Intronic
906666919 1:47628473-47628495 CTGGGAGTATCAAGGTGAGAGGG - Intergenic
906795002 1:48689684-48689706 CTGTGTGTGTTGGGATGAGATGG + Intronic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907520887 1:55022570-55022592 CTGCGTTTATGGAGGAGAGAAGG - Intergenic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
907784968 1:57602780-57602802 GTGTGTGTGTGGAGGGGAGTGGG + Intronic
907986376 1:59535085-59535107 GTGTGTCTCTGCAGGTGAGATGG - Intronic
908146238 1:61247614-61247636 ATGTGTGAGGGGAGGTGAGAGGG + Intronic
908552706 1:65225486-65225508 CTGTGTGTATGTGTGTGAGGGGG + Intronic
909303303 1:74040040-74040062 ATGTGTGTCTGCACGTGAGATGG - Intronic
909370632 1:74879243-74879265 CTGTGTCTCTGCACGTGAGATGG - Intergenic
909449667 1:75784518-75784540 CTGTGTGTGTGGCGAGGAGAGGG + Intronic
909841589 1:80334225-80334247 GTGTGTCTTTGCAGGTGAGATGG - Intergenic
910391186 1:86746304-86746326 CTGTCAGCATGGAGGTGAGTGGG - Intronic
910873019 1:91852285-91852307 GTGTGTGTGTGGAGGTGGGGTGG - Intronic
911436622 1:97867931-97867953 TTGTGTGTTTGCAGGTGACATGG + Intronic
911516971 1:98879481-98879503 GTGTGTCTCTGGATGTGAGATGG + Intergenic
911823080 1:102444319-102444341 GTGTGTGTCTGCACGTGAGATGG - Intergenic
911851709 1:102828733-102828755 GTGTGTGTCTGCACGTGAGATGG - Intergenic
912249525 1:107996554-107996576 CTGTGTGTTTGGTGCTGAGTGGG + Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912751296 1:112290228-112290250 CTGTGTCTCTGCATGTGAGATGG - Intergenic
912922029 1:113877959-113877981 CTGTGGGTATGGAATTGAGAAGG + Intergenic
913243705 1:116852743-116852765 CTGGGAGTATGGAAGTGAGATGG + Intergenic
913467192 1:119155160-119155182 GTGTGTGTCTGCACGTGAGATGG + Intergenic
913489871 1:119368922-119368944 CTGTGTGCTTGGAACTGAGAAGG + Intronic
915862050 1:159455066-159455088 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
916493807 1:165326930-165326952 GTGTGTGTCTGGGGGTGAGGGGG - Intronic
916738884 1:167631080-167631102 CTGTGTGTATGGAGGTATGCTGG + Intronic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
917712018 1:177694757-177694779 CTGTGTCTCTGCATGTGAGATGG - Intergenic
917921405 1:179753655-179753677 GTGTGTATATGGTGGTGGGAAGG + Intronic
918089650 1:181278084-181278106 ATGTGTGTCTGCACGTGAGATGG - Intergenic
918439774 1:184555534-184555556 GTGTGTGTATGTATGTGTGAGGG - Intronic
918614581 1:186530049-186530071 GTGTGTCTTTGCAGGTGAGATGG + Intergenic
919822776 1:201483492-201483514 CTGTGTCTGTGGAGCTGGGAGGG - Intergenic
920333588 1:205229191-205229213 GTGTGTGTATGTGTGTGAGACGG + Intronic
920573571 1:207037444-207037466 CTGTGTGGATGGAAGAGAGAAGG - Intronic
921509595 1:216012538-216012560 CAGACTGTATAGAGGTGAGAAGG - Intronic
922433066 1:225575129-225575151 CTGTGTGTGTGGAGCAGTGAGGG - Intronic
922935209 1:229417306-229417328 CTGACTGTATAGAGGTGGGAAGG - Intergenic
923047491 1:230366297-230366319 CTGTCTGTAGGGATGAGAGATGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923409783 1:233695554-233695576 GTGTGTGTATGGAGGTAGGCTGG - Intergenic
923526801 1:234778966-234778988 CTGTGTGTCTTGACTTGAGATGG + Intergenic
924199623 1:241645507-241645529 CTGTGAGGGTGGAGGTGAGAAGG + Intronic
924543632 1:245005018-245005040 CTGTGTCTATTGAGATGACATGG + Intronic
924659145 1:246000607-246000629 CTGTGTGTATGGTGGTGTCCAGG - Intronic
924946297 1:248849149-248849171 ATGTGGGTATGGAGGTGGGTGGG + Exonic
1062957718 10:1551415-1551437 CTGTCTGGGTGAAGGTGAGAAGG - Intronic
1063174670 10:3540592-3540614 CTGTGTGTGTGGGGGAGAGTGGG - Intergenic
1063251813 10:4282178-4282200 CTGTGAGTGTCGAGGTGAGTCGG - Intergenic
1063528553 10:6808032-6808054 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1063554116 10:7061922-7061944 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1064925923 10:20568983-20569005 GTGTGTGTCTGCATGTGAGATGG - Intergenic
1064959122 10:20944038-20944060 CTGTGTGTCTGAAAGTTAGATGG - Intronic
1065077123 10:22091524-22091546 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
1065091200 10:22235411-22235433 TGGTGTGAATGGGGGTGAGAAGG - Intergenic
1065117674 10:22498236-22498258 CTCTATGTATGCAGGTCAGAGGG + Intergenic
1066595180 10:37042640-37042662 ATGTGTGTCTGCACGTGAGATGG + Intergenic
1069745739 10:70713734-70713756 CGCTGTGTATGGGGGTGAGTTGG + Intronic
1070161317 10:73868309-73868331 GTGTGGGGATGGAGGTGGGAAGG - Intronic
1070183158 10:74033927-74033949 CAGTGTGAATGGAGATGAGAGGG - Intronic
1070776798 10:79114531-79114553 GTGTGTGTGTGAAGGTGGGAGGG + Intronic
1073031402 10:100529227-100529249 CTCTGTGGAGGGAGGTGGGAGGG - Intronic
1073200101 10:101728304-101728326 CTGTGTTTATGGAGGACAGAGGG - Intergenic
1074286891 10:112106039-112106061 ATGTGTGTCTGCACGTGAGACGG - Intergenic
1074288811 10:112122851-112122873 CTGTGTCTAAGGAGGTAGGAAGG + Intergenic
1074883384 10:117675931-117675953 CTGGGGGTAGGGAGGAGAGAAGG - Intergenic
1076117170 10:127908426-127908448 CTGTGTGTATGTGGGTGGGGAGG + Intronic
1076390031 10:130092671-130092693 GTGTGTCTTTGCAGGTGAGATGG - Intergenic
1076542958 10:131225742-131225764 CTGTGTGCAGGGAGTTGGGAGGG - Intronic
1076591189 10:131584670-131584692 CAGGGTGTATGGGGGTGAGCTGG - Intergenic
1077544179 11:3161954-3161976 CTGTGAGCAAGGAGGGGAGAGGG + Intronic
1077793786 11:5469457-5469479 CTGGGTGAATTGAGGTGAGATGG + Intronic
1078341450 11:10500381-10500403 CTGTGTGTTTTGAGGTGTGTGGG - Intronic
1078449379 11:11428886-11428908 GTGTGTGTATGGGTGTGAGTGGG + Intronic
1078481210 11:11677280-11677302 ATGTATGTATGTATGTGAGATGG - Intergenic
1078819593 11:14864059-14864081 ATGTGTGTCTGCACGTGAGATGG - Intronic
1078943029 11:16030779-16030801 CTTTGTGGGTGGTGGTGAGAAGG - Intronic
1079698130 11:23509603-23509625 GGGTGTGTTTGGAGGTGACAGGG - Intergenic
1080313881 11:30926257-30926279 CTGAGTGTATGGACATGAGGAGG + Intronic
1081407325 11:42713095-42713117 CTGTTTGTATGGAGGTGCATTGG - Intergenic
1081646205 11:44792407-44792429 CTGAGTGGAAGGAGGTGAGCGGG + Intronic
1082063427 11:47879772-47879794 ATGTGTGTCTGGAGGTGGGGAGG - Intergenic
1082150791 11:48736134-48736156 GTGTGTGTCTGCACGTGAGATGG - Intergenic
1082210785 11:49498653-49498675 ATGTGTGGCTGGAGGTGAGCTGG - Intergenic
1082717404 11:56631197-56631219 GTATGTGTATGTTGGTGAGAGGG - Intergenic
1082744124 11:56944038-56944060 CTGTGTCTTTGCACGTGAGATGG + Intergenic
1084343538 11:68526565-68526587 GTGTGTGAATAGAGGTAAGATGG - Intronic
1084564051 11:69919702-69919724 CTGTGTGTATGCATGTGTGGTGG - Intergenic
1084610862 11:70202281-70202303 CCGTGGGTCTGGAGGTGAGGAGG - Intergenic
1085038753 11:73314694-73314716 CTGTGTGCCGGGAGGTGAGGAGG + Intronic
1085152135 11:74260811-74260833 ATGTGCATATGGAGGTGTGAAGG - Intronic
1085809209 11:79665375-79665397 CTTTGTGTATCCAGGTAAGATGG + Intergenic
1086134386 11:83431943-83431965 CGGAGTGTATAGAGGTGGGAAGG + Intergenic
1086248301 11:84782391-84782413 ATGTGTGTATGTAGGTGGGTGGG - Intronic
1086386304 11:86312446-86312468 ATGTGTGTCTGCACGTGAGATGG + Intronic
1086409337 11:86528109-86528131 ATGTGTCTATGCACGTGAGATGG - Intronic
1086516725 11:87622041-87622063 CTGTGTCTCTGCAGGTGAGATGG + Intergenic
1086519766 11:87656450-87656472 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1086638854 11:89126136-89126158 ATGTGTGGCTGGAGGTGAGCTGG + Intergenic
1086661826 11:89428470-89428492 ATGTGTGTCTGCATGTGAGATGG - Intronic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1087007969 11:93487434-93487456 GTGGGTGTATGGAGGGGAGGAGG + Intronic
1087087653 11:94236405-94236427 GTGTGTGTCTGCACGTGAGATGG + Intergenic
1087089185 11:94250288-94250310 GTGTGTGTCTGCACGTGAGATGG - Intergenic
1087410314 11:97783337-97783359 GTGTGTCTTTGCAGGTGAGATGG + Intergenic
1089619830 11:119715783-119715805 CTGGGTGGATGGTGGAGAGATGG - Intronic
1090641887 11:128736835-128736857 CTGTGTGTATGCAGGTGTGTGGG + Intronic
1091150885 11:133326975-133326997 GTGTGTGTATGTGGGTGAGGGGG + Intronic
1091798306 12:3309595-3309617 CTGTGTGGGTACAGGTGAGAGGG + Intergenic
1092697935 12:11194435-11194457 CTGTGTGTATGAATGTAATATGG + Intergenic
1092971518 12:13700101-13700123 CTGTCTGTGGGGAGGTGGGATGG + Intronic
1093125734 12:15326117-15326139 GTGTGTGTATGGGGTTGCGAGGG - Intronic
1093275368 12:17118599-17118621 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
1093544029 12:20323872-20323894 CTGTGTGTGTGTATGAGAGAGGG + Intergenic
1093571430 12:20669953-20669975 ATGTGTGTCTGCACGTGAGATGG - Intronic
1093782065 12:23148084-23148106 CTGTGTCTCTGCATGTGAGATGG - Intergenic
1093813858 12:23519543-23519565 GTGTGTGTCTGCATGTGAGATGG + Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1095370202 12:41458159-41458181 TTGTGTGTGTGTATGTGAGATGG + Intronic
1095994121 12:48064679-48064701 GTGTGTGTGTGTATGTGAGATGG + Intronic
1096124169 12:49107503-49107525 CAGTGTGCATGGAGGTAGGAGGG - Intronic
1096358884 12:50966503-50966525 CTGAGGGTGTGGAGGTGGGAAGG - Intronic
1096423954 12:51485050-51485072 CTGTGTGTTTGGAGCAGAGTGGG + Intronic
1096545802 12:52339463-52339485 GAGTGTGTCTGAAGGTGAGAGGG - Intergenic
1097201893 12:57286118-57286140 TTGTGTGTATGTTGGAGAGATGG + Intronic
1097321428 12:58230827-58230849 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1098504956 12:71238713-71238735 CTTTATGGATGGGGGTGAGAGGG - Intronic
1099538359 12:83873200-83873222 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
1099889612 12:88574689-88574711 GTGTGTGCATGGAGTTGAAATGG - Intronic
1100624627 12:96318052-96318074 GTGTGTGTCTGCATGTGAGATGG - Intronic
1101768342 12:107724327-107724349 CTGTGTCTCTGCACGTGAGATGG - Intergenic
1102576925 12:113861504-113861526 GTGTGTGTGTGAAGGAGAGAAGG + Intronic
1102583875 12:113909735-113909757 AAGTGGGTCTGGAGGTGAGAAGG - Intronic
1102708486 12:114903969-114903991 CTGTGTGTATGAAAGTGTGTAGG + Intergenic
1102805381 12:115774993-115775015 CTGTGGATATGGATGGGAGAAGG - Intergenic
1103203412 12:119108708-119108730 GTGTGTCTCTGCAGGTGAGATGG + Intronic
1103413760 12:120730694-120730716 CTGTGTTTCTGGGGATGAGATGG + Intronic
1104024806 12:125017988-125018010 GTGTGTGTAGGGTGGTGGGATGG + Intronic
1104472476 12:129041437-129041459 GTGTGTGTCTGCACGTGAGATGG + Intergenic
1104474468 12:129059789-129059811 GTGTGTGTCTGCACGTGAGATGG + Intergenic
1106598911 13:31170675-31170697 TTGTGTGTAAGGAGATGTGAGGG + Intergenic
1107295934 13:38907545-38907567 CTGTGTGTATGGAGTTTACATGG + Intergenic
1107433240 13:40358407-40358429 GTGTGTGTCTGCACGTGAGATGG - Intergenic
1107476116 13:40737035-40737057 GTGTGTGTCTGCACGTGAGATGG - Intronic
1108576583 13:51796443-51796465 GTATCTGTATGGAGGTGAGGGGG + Intronic
1109290531 13:60469409-60469431 GTGTGTGTGTGTTGGTGAGAAGG - Intronic
1110295243 13:73856523-73856545 GTGCGTGTATGGAGGAGGGAGGG - Intronic
1111128579 13:83944345-83944367 CTGTGTGTGTGGTGGGGTGATGG + Intergenic
1111273326 13:85915676-85915698 ATGTGTGTCTGCATGTGAGATGG + Intergenic
1111368207 13:87278894-87278916 GTGTGTGTGTGTATGTGAGATGG - Intergenic
1111458525 13:88514164-88514186 CAGACTGTATTGAGGTGAGAAGG + Intergenic
1113078830 13:106494843-106494865 CTGTGTGTATGGAGGTCTGTGGG - Intronic
1113192282 13:107762553-107762575 CATTGTGTATGGAGGTAAGGCGG + Intronic
1113333192 13:109352033-109352055 GTGTGTGTGTGGAGGTGAGAGGG + Intergenic
1114061809 14:19025517-19025539 CAGTGTGTGTGGTGGTGTGACGG - Intergenic
1114100451 14:19374485-19374507 CAGTGTGTGTGGTGGTGTGATGG + Intergenic
1114560783 14:23589042-23589064 CTGTGGGGGTGGAGGTGGGAGGG + Intergenic
1114744613 14:25134340-25134362 CTGAGTGTAAGGAGATGAGGTGG - Intergenic
1114811164 14:25901305-25901327 GTGTGTGTATAGGGGGGAGATGG - Intergenic
1115124433 14:29974591-29974613 GTGTGTCTTTGCAGGTGAGATGG - Intronic
1116171680 14:41410286-41410308 CTCTTTCTATGGAGGTTAGAAGG - Intergenic
1116384252 14:44311154-44311176 ATGTGTGTCTGCATGTGAGATGG - Intergenic
1116401564 14:44514075-44514097 GTGTGTGTCTGCATGTGAGATGG + Intergenic
1116534457 14:46013757-46013779 CAGACTGTATAGAGGTGAGAAGG + Intergenic
1117099362 14:52331007-52331029 ATGTGTGTAAAGAGGTCAGAGGG - Intergenic
1117121311 14:52570600-52570622 ATGTGTCTTTGCAGGTGAGACGG - Intronic
1117170259 14:53086899-53086921 GTGTGTGTCTGCATGTGAGATGG - Intronic
1117593403 14:57300512-57300534 GTGTGTGTGTGTAGGTGAGGTGG - Intergenic
1117784890 14:59272657-59272679 ATGTATGTATGTAGGAGAGAGGG + Intronic
1118104165 14:62638796-62638818 ATGTGTCTCTGCAGGTGAGATGG - Intergenic
1118146451 14:63142871-63142893 GTGTGTGTCTGCACGTGAGATGG + Intergenic
1118375581 14:65174088-65174110 CTGAGTGTGTGGGGGTGTGATGG + Intergenic
1118521108 14:66586275-66586297 ATGTGTGTCTGCATGTGAGATGG + Intronic
1119414258 14:74459123-74459145 CTCTGTCTCTGGAGGGGAGAGGG + Intergenic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119735392 14:76978146-76978168 TTGTGTGGGTGGAGGTGGGAGGG + Intergenic
1119877449 14:78072952-78072974 AGGTGTGTGTGGAGGTGAGCAGG - Intergenic
1120353263 14:83392046-83392068 GTGTGTGTATGGATGTGAAAGGG + Intergenic
1120471572 14:84932568-84932590 CAGTGTGATTGGAAGTGAGATGG + Intergenic
1120560115 14:85981013-85981035 GTGTGTGTGTGTAGGTGAGTTGG - Intergenic
1120770326 14:88372124-88372146 TTGTGTCTTTGGACGTGAGATGG - Intergenic
1120961280 14:90127356-90127378 CTGTGTGTATGGATCTGAGCCGG + Intronic
1121333044 14:93059931-93059953 CAGTGTGGATGGGGGTGAGCAGG - Intronic
1121407249 14:93726476-93726498 GTGTGTGTATGGGTGTGGGAGGG - Intronic
1121576737 14:94995168-94995190 ATGTGTGAATGGAGATGGGAAGG - Intergenic
1122255736 14:100474356-100474378 CTGTGTTTGTGGAGATGTGAAGG - Intronic
1122357565 14:101132712-101132734 CTGTCTCCAGGGAGGTGAGAGGG - Intergenic
1122606074 14:102948287-102948309 GGGTGGGTGTGGAGGTGAGACGG + Intronic
1122606166 14:102948499-102948521 TGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122606250 14:102948707-102948729 GGGTGGGTGTGGAGGTGAGAGGG + Intronic
1123015468 14:105371904-105371926 CTGTGTGTTGTGTGGTGAGAGGG + Intronic
1123054654 14:105563527-105563549 GTGTGTGTATGAGGGTGTGAGGG + Intergenic
1124632499 15:31345570-31345592 CTGTGAGTATGAGGGTGGGACGG + Intronic
1124636838 15:31371021-31371043 GGGTCTGTATGGGGGTGAGAGGG + Intronic
1124997262 15:34735911-34735933 CTGTGTGGATGGAGTTGGCAAGG - Intergenic
1125185358 15:36923849-36923871 CTGTATGGAGGGAGGTGACATGG - Intronic
1125212897 15:37237525-37237547 CAGACTGTATAGAGGTGAGAAGG + Intergenic
1125365399 15:38909548-38909570 CTGTGTCTCTGGAGGTGAAGTGG + Intergenic
1126071468 15:44868383-44868405 ATGTGTGTCTGCATGTGAGATGG - Intergenic
1126284350 15:46994673-46994695 GTGTGTCTTTGAAGGTGAGATGG + Intergenic
1126702168 15:51378172-51378194 GTATGTGAATGGAGGTGAGATGG + Intronic
1126720305 15:51571039-51571061 ATGTGTGTCTGCATGTGAGATGG - Intronic
1127188942 15:56509048-56509070 CTGTGTCTTTGCATGTGAGATGG - Intergenic
1127193936 15:56563650-56563672 CTGTGTCTCTGCATGTGAGATGG - Intergenic
1128339620 15:66811875-66811897 CTGTGTCTCTGCATGTGAGATGG + Intergenic
1128758887 15:70201494-70201516 GTGTGTGTTTGGAGTTGGGATGG - Intergenic
1129233652 15:74210663-74210685 CTGTGAGTAAGGAGCTGTGAAGG + Intronic
1130539569 15:84812449-84812471 TTGTGTGTATGGGGATGAGGTGG + Intergenic
1130977236 15:88786462-88786484 CTGTGTGTGTGTTGGGGAGAGGG - Intergenic
1131095533 15:89652365-89652387 CCATCTCTATGGAGGTGAGAAGG + Intronic
1131589443 15:93732096-93732118 CTGTGTCTTTGGAGGTCAGGGGG + Intergenic
1131664853 15:94559244-94559266 CTTTTAGTATGGATGTGAGATGG - Intergenic
1131686790 15:94776941-94776963 GTGTGTGTATGGGGGGGAGGGGG - Intergenic
1131892894 15:96992813-96992835 GTGTGTGAAAGAAGGTGAGATGG + Intergenic
1132667125 16:1086636-1086658 TTGTGTGTGTGGAGGGGTGAGGG + Intergenic
1133467202 16:6039090-6039112 CTGTGTGCATAGCGGGGAGAAGG + Intronic
1133523544 16:6581724-6581746 CTGTGTTTATGGAGGTCACCTGG + Intronic
1134193245 16:12138705-12138727 CTGTGTTTATGGATGAGAGGAGG + Intronic
1135407413 16:22207844-22207866 CTGTGTGTGTAAAGGGGAGAGGG + Intronic
1135849881 16:25953589-25953611 CTGGGTGAATGGGGATGAGATGG + Intronic
1136220733 16:28826423-28826445 CTGTGTGCATAGAGGACAGAGGG + Intronic
1136662323 16:31773865-31773887 ATGTGTCTTTGCAGGTGAGATGG - Intronic
1137074578 16:35945940-35945962 CTGTGTCTCTGCATGTGAGATGG - Intergenic
1137075595 16:35957246-35957268 CTGTGTCTCTGCATGTGAGATGG + Intergenic
1137373756 16:47933023-47933045 CTGTGTGTGTTGAGGGGTGAGGG - Intergenic
1137494286 16:48957784-48957806 CTGTGTGCTGGGAGGTGGGATGG - Intergenic
1139631290 16:68233491-68233513 ATGTGTCTATGGAGGGGAGTTGG - Intronic
1140341074 16:74162847-74162869 CTGTGTGTGTGGTTGTGAGAGGG + Intergenic
1140717266 16:77738050-77738072 GTGTGTGTATGAAAGCGAGATGG + Intronic
1140901579 16:79372810-79372832 CAGTGGGTCTGGAGCTGAGAGGG - Intergenic
1141167299 16:81669159-81669181 GGGTGTGGAAGGAGGTGAGAGGG - Intronic
1141167339 16:81669345-81669367 GGGTGTGGAAGGAGGTGAGAGGG - Intronic
1141336692 16:83162710-83162732 CTGTGTGTATGTGTGTCAGAGGG - Intronic
1142554078 17:760914-760936 CTGTATGTATGTATATGAGACGG - Intronic
1142701106 17:1661503-1661525 ATGGTTGTATGGAGGTGAGAAGG - Intronic
1142736768 17:1905884-1905906 CTGTGTGTATGGGGGTGTGCTGG + Intergenic
1142759279 17:2033968-2033990 GTGTGTGTATGGTTGTGGGAGGG - Intronic
1143644249 17:8219737-8219759 CTGTGTGGATGGTGGTGAGATGG + Intergenic
1143866480 17:9927276-9927298 GTGTGTGTATGTAGTAGAGATGG - Intronic
1144132119 17:12256168-12256190 CTGTGTGTAAGAATGTAAGAAGG - Intergenic
1144699124 17:17325311-17325333 CTGAGTGTCTGGAGCTCAGAGGG - Intronic
1146297657 17:31662205-31662227 CTGAGTGTCTGGAGCTCAGATGG + Intergenic
1146462460 17:33057025-33057047 GTGTGTTTAAGGAGGTGGGAAGG + Intronic
1146519658 17:33516422-33516444 GTGTGTGTATGGAGGAGGGGTGG + Intronic
1146820825 17:35982645-35982667 CTCTGTTTATGGAGGTGACAAGG + Intergenic
1147031966 17:37645759-37645781 ATGTGTGAATGGAGAAGAGAAGG + Intergenic
1148028467 17:44604319-44604341 TTGTGTTTAGGGAGGGGAGAGGG + Intergenic
1148105181 17:45115056-45115078 CTGGGTGTCTGGGGGCGAGAGGG - Intronic
1148235181 17:45964002-45964024 CTCTGGGTGAGGAGGTGAGAGGG + Intronic
1149397491 17:56259895-56259917 GTGTGTGTTTGGAGGTGGGGTGG - Intronic
1150432433 17:65129169-65129191 CTCTTTGTAAGGAGCTGAGAGGG - Intergenic
1150810727 17:68354949-68354971 GTGTGTGCATGTAGGTGTGATGG + Intronic
1151099455 17:71540076-71540098 GTGTGTGTATGTATGTGAGTAGG - Intergenic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151393938 17:73807459-73807481 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
1151774895 17:76193896-76193918 CTGTGGATGTGGAGGTGGGAGGG - Intronic
1152271596 17:79328177-79328199 CTGTGTGTCTGGAACGGAGATGG + Intronic
1153355515 18:4130659-4130681 CTGTGTGTATGTGTGTGCGATGG - Intronic
1153825556 18:8871033-8871055 CTGAGTTTCTGGAGGTGGGAAGG - Intergenic
1153827904 18:8893662-8893684 CTGTGTGGCTGGAGGAGAGGAGG + Intergenic
1156228982 18:35135825-35135847 CTGTGTGTACAGAGCTGAGATGG + Intronic
1156435427 18:37122714-37122736 CTGTGAATCAGGAGGTGAGATGG + Intronic
1156454242 18:37283976-37283998 TTGTGTGTTGGGATGTGAGATGG - Intronic
1156463657 18:37335503-37335525 GTGTGTGTGTGGAGGTGTGGGGG + Intronic
1156627819 18:38931017-38931039 GTGTGTGTGTGGAGGTGGGGAGG + Intergenic
1156640236 18:39086272-39086294 TTGTGGGTGTGGAGGTGTGAAGG + Intergenic
1157847595 18:51017988-51018010 CTGTGTGTAAGGGGCAGAGAAGG - Intronic
1157918470 18:51692741-51692763 GTGTGTGTGTGGAGGGGAGGGGG + Intergenic
1157966542 18:52215231-52215253 GTGTGTGTGTGGTGGAGAGAAGG - Intergenic
1158394328 18:57067963-57067985 CAGACTGTATAGAGGTGAGAAGG + Intergenic
1158638311 18:59180439-59180461 CTGTTAGTCTGGAGCTGAGAGGG + Intergenic
1159005755 18:63008897-63008919 CTGTGTGTAGGGAGAAGAGAGGG - Intergenic
1159441842 18:68490459-68490481 CTATGTGAATGCAGGTGACAGGG + Intergenic
1159688929 18:71460714-71460736 GTGTGTGTGTGGAGGTGGGGTGG + Intergenic
1159997551 18:74980887-74980909 CAGTGTGTCTGGGGCTGAGAAGG - Intronic
1161125922 19:2557000-2557022 GTGTGTGTGTAGAGGTGGGAGGG - Intronic
1161347162 19:3774193-3774215 GTGTGGGTATGGAGGTGCAAGGG + Intergenic
1161482896 19:4519563-4519585 CTGTGTTATTGGGGGTGAGAGGG + Intergenic
1161627090 19:5333608-5333630 CTTTGTGGCTGGAGGTGAGGGGG - Intronic
1161650833 19:5483693-5483715 CAGTGTTTAGGGAGGTGAGGCGG + Intergenic
1162095200 19:8306122-8306144 CAGGGTGTAGGGAGGAGAGAGGG - Intronic
1162320295 19:9967446-9967468 TTGTGTGTATGTTGGTGGGAAGG - Intronic
1163165329 19:15493594-15493616 GTGTGTCTCTGCAGGTGAGATGG + Intronic
1163722827 19:18906374-18906396 CTCTGTGGATGGAGGTGGGATGG + Intronic
1163949921 19:20574501-20574523 ATGTTAGTATTGAGGTGAGAAGG + Intronic
1164091248 19:21954722-21954744 GTGTGTCTCTGCAGGTGAGATGG + Intronic
1164111050 19:22159413-22159435 GTGTGTCTCTGGATGTGAGATGG + Intergenic
1164132942 19:22382562-22382584 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1164165875 19:22674171-22674193 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
1164420750 19:28089886-28089908 CTGTGTCTCTGCAGGTGAGATGG - Intergenic
1165198014 19:34121319-34121341 CTGTGTGTATGGGGCTGTTAGGG - Intergenic
1165723106 19:38093614-38093636 GTGTGTGTGTGGATATGAGAAGG - Intronic
1166103876 19:40588200-40588222 ATGAGGGTATGGAGGTGACAAGG + Intronic
1166198335 19:41220621-41220643 CTGCGTGCCTGGAGGGGAGATGG - Exonic
1166455613 19:42937655-42937677 CTGTGTGTTTCCTGGTGAGAGGG + Intronic
1166887707 19:45972102-45972124 CTGTGTGTATGGGTGTAACAAGG - Intronic
1166933892 19:46319484-46319506 CTGTGTGAAGGGAGGTGCCAGGG + Intronic
1167250266 19:48395499-48395521 GTGTGTGTTGGGAGGTGAGGGGG + Intronic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1167449905 19:49560927-49560949 CTCTTTGTTTGGAGGTAAGAGGG + Intronic
1167607017 19:50486881-50486903 CTGGGTGGAAGGAGGGGAGAGGG - Exonic
1167834201 19:52053206-52053228 GTGTGTGTCTGCACGTGAGATGG - Intronic
1168475668 19:56673424-56673446 CTGTGTGTGTGGATGGGAGGAGG + Intergenic
1202673822 1_KI270710v1_random:22214-22236 GTGTGTCTCTGCAGGTGAGAAGG + Intergenic
925281833 2:2690419-2690441 GTGTGAGTAGGGAGGAGAGAGGG - Intergenic
925774311 2:7319123-7319145 CTGTGTGTGTGGTGGGGGGAGGG + Intergenic
925999304 2:9317373-9317395 GTGTGTGTGTGGATGTGAGTTGG - Intronic
926011011 2:9407882-9407904 CTGTGTGTTTGGGGGTGGGGGGG + Intronic
926266176 2:11323747-11323769 CTATGTGTATGCAGGGGTGAGGG - Intronic
926339697 2:11894846-11894868 CTGAGGGTAAGGAGGTGGGAAGG + Intergenic
927011770 2:18911634-18911656 GTGTGTGTGTGTTGGTGAGAAGG + Intergenic
927242789 2:20933139-20933161 CTGTATGTATGTTGGGGAGAGGG + Intergenic
927392742 2:22613196-22613218 CGGTGTCTATGGGGGTGATACGG + Intergenic
928111844 2:28516895-28516917 GCGTGTGTATGGAGGGGAGAGGG + Intronic
928488512 2:31756610-31756632 CTGTGTCTTTGCACGTGAGATGG - Intergenic
928488593 2:31757700-31757722 CTGTGTCTTTGCATGTGAGATGG + Intergenic
928821841 2:35371039-35371061 ATGTGTGTCTGGAGGAGGGATGG + Intergenic
928900272 2:36310087-36310109 GTGTGTCTATGCATGTGAGATGG - Intergenic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
930706295 2:54508178-54508200 CGGACTGTATAGAGGTGAGAAGG + Intronic
931043836 2:58327578-58327600 ATGTGTGTCTGCACGTGAGATGG - Intergenic
931477843 2:62607475-62607497 CTGTGTCTCTGCACGTGAGATGG - Intergenic
931516578 2:63053736-63053758 GTGTGTGTGTGCAGGGGAGAGGG + Intronic
931977280 2:67656332-67656354 GTGTGTGTCTGCATGTGAGATGG - Intergenic
931978847 2:67672556-67672578 GTGTGTGTATGTATGTGAGGTGG - Intergenic
931985971 2:67742853-67742875 CTGTGTCTCTGCATGTGAGATGG + Intergenic
932051345 2:68401619-68401641 GTGTGTCTTTGCAGGTGAGATGG + Intergenic
932052043 2:68407455-68407477 ATGTGTCTTTGCAGGTGAGATGG - Intergenic
932423497 2:71614810-71614832 CTGTCTGTATGGATCTGAGGAGG + Intronic
932469213 2:71942984-71943006 GTGTGTGTGTGGTGGGGAGATGG + Intergenic
933086231 2:78058064-78058086 TTCTCTGTATGGAGTTGAGATGG + Intergenic
933189146 2:79313818-79313840 GTGTGTGTTTGGGGGTAAGAGGG + Intronic
933700292 2:85250342-85250364 CTGTGTGTGGCAAGGTGAGAAGG - Intronic
933729254 2:85444910-85444932 GTCTGTGAATGGAGGGGAGAGGG + Intergenic
934768614 2:96894415-96894437 CTGTGTGTACGTGGGTGAGTGGG - Intronic
934768635 2:96894497-96894519 CTGTGTGTATGTGGGTGGGTGGG - Intronic
934858708 2:97745702-97745724 CTGTGGGTGGGGATGTGAGATGG + Intergenic
934877478 2:97938282-97938304 GTGTGTCTCTGCAGGTGAGATGG - Intronic
934942227 2:98510996-98511018 ATTTGTGTCTGCAGGTGAGAAGG + Intronic
935952426 2:108343246-108343268 CTGTGTCTTTGCATGTGAGATGG + Intergenic
936126039 2:109789828-109789850 CTGGGAGCATGGAGGTGAAAAGG + Intergenic
936218654 2:110581640-110581662 CTGGGAGCATGGAGGTGAAAAGG - Intergenic
936627480 2:114163848-114163870 CTGTGACTATGGGGGAGAGAAGG + Intergenic
936769312 2:115892965-115892987 GTGTGTCTATGCACGTGAGATGG + Intergenic
937184319 2:120025437-120025459 GTGTGTCTTTGCAGGTGAGATGG + Intronic
937534380 2:122867629-122867651 CTGTGTCGATAGAGATGAGATGG - Intergenic
937880372 2:126859863-126859885 CTGTATGCATGGAGGGGAGGTGG + Intergenic
938192223 2:129294094-129294116 GTGTGTGTCTGCATGTGAGATGG - Intergenic
938567376 2:132531107-132531129 ATGTGTCTCTGCAGGTGAGATGG - Intronic
938894721 2:135738591-135738613 CAGTGAGTGTGAAGGTGAGAAGG - Intergenic
939033498 2:137103637-137103659 ATGTGTGTCTGTATGTGAGATGG - Intronic
939168379 2:138664397-138664419 CTGTGTGTATGGAGTTTTTATGG - Intergenic
939777832 2:146407857-146407879 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
939937530 2:148311536-148311558 GTGTGTGTTTGCATGTGAGATGG + Intronic
940475047 2:154151818-154151840 GTGTGTGTCTGCATGTGAGATGG + Intronic
940644241 2:156374140-156374162 CTGTGTTTCTGCACGTGAGATGG + Intergenic
940820834 2:158353330-158353352 GTGTGTGTCTGCACGTGAGATGG - Intronic
941106021 2:161354230-161354252 CTGTGTGTATGTGTGTCAGATGG + Intronic
941396851 2:164983878-164983900 CTTTGGGTATGGGTGTGAGAGGG + Intergenic
941404021 2:165066558-165066580 CTGTGTGTGTGTATGTGGGAGGG + Intergenic
942986426 2:182148268-182148290 CTGTGTGTGTGGAGGGGGGTGGG + Intronic
944018312 2:195071411-195071433 GTGTGTGTCTGCACGTGAGATGG + Intergenic
944042968 2:195377106-195377128 GTGTGTGTCTGCACGTGAGATGG + Intergenic
944056297 2:195525240-195525262 GTGTGTGTCTGCACGTGAGATGG - Intergenic
944393384 2:199243480-199243502 GTGTGTGTCTGCACGTGAGATGG + Intergenic
944423810 2:199558224-199558246 CTCTGTGTTTGGTGGTGAGTGGG + Intergenic
945207462 2:207346695-207346717 GTGTGTCTATGCATGTGAGATGG - Intergenic
945355421 2:208833824-208833846 GTGTGTCTCTGCAGGTGAGATGG - Intronic
945481340 2:210349436-210349458 ATGTGTGTCTGCACGTGAGATGG + Intergenic
945551032 2:211221438-211221460 GTGTGTGTCTGCACGTGAGATGG - Intergenic
945776487 2:214112709-214112731 GTGTGTCTCTGCAGGTGAGATGG + Intronic
945970832 2:216229621-216229643 CTGTGTCTATCGAGATGATATGG + Intergenic
945988100 2:216371178-216371200 GTGTGTGTACCGGGGTGAGAGGG + Exonic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946353212 2:219169006-219169028 GTGGGTATCTGGAGGTGAGAAGG - Intronic
946550493 2:220796021-220796043 CTGTGTGTTTGTAGGTGATTGGG - Intergenic
946759677 2:222981107-222981129 GTGTGTGTGTGGTGTTGAGAAGG - Intergenic
947033731 2:225826827-225826849 ATGTGTGTCTGCACGTGAGATGG - Intergenic
947115991 2:226771196-226771218 CTGTGTTTATCAAGGTCAGAAGG + Intronic
947174455 2:227349210-227349232 CTGTGTATATGCTGGTGAGGGGG - Intronic
947842396 2:233216425-233216447 CTGACTGTATAGAGGTGGGAAGG + Intronic
948265647 2:236633457-236633479 GTGTGTGTCTGGAGCTGGGATGG + Intergenic
948678247 2:239611735-239611757 CAGTGTGACTGGAGGTGTGATGG - Intergenic
948896393 2:240929901-240929923 CTGCGTGCATGGAGGTGGGAGGG - Intronic
949042521 2:241855857-241855879 GTGTGTGTGTGGAGGTGGGAAGG + Intronic
1169646047 20:7811043-7811065 GTGTGTCTTTGCAGGTGAGATGG + Intergenic
1170111035 20:12804908-12804930 GTGTGTCTCTGGACGTGAGATGG + Intergenic
1170268581 20:14498813-14498835 GTATGTGGAGGGAGGTGAGAGGG - Intronic
1171054193 20:21889771-21889793 CTGTGTCTCTGCACGTGAGATGG - Intergenic
1171508141 20:25656177-25656199 CTGTGTCTTTAGAGGTGAAATGG + Intergenic
1171514402 20:25717542-25717564 CTGTGTCTCTGCACGTGAGATGG + Intergenic
1171791308 20:29528014-29528036 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
1171885029 20:30645921-30645943 CTGTCTGTAGGGTGGTGGGAGGG - Intergenic
1171935039 20:31266919-31266941 CTGTGTCTCTGCACGTGAGATGG + Intergenic
1171940307 20:31322658-31322680 CTGTCTGTTTGGATGTGGGAGGG - Intergenic
1172601989 20:36190417-36190439 CCATGTGTATGGAGGGGAGCAGG + Intronic
1172802843 20:37590300-37590322 CTGTGTGTATGGCTGTGAATGGG + Intergenic
1173994110 20:47324647-47324669 CTGAGTGAATGAAGGAGAGAAGG - Intronic
1175134483 20:56812643-56812665 GTGTGTGTTTGGGAGTGAGAGGG + Intergenic
1175323698 20:58107735-58107757 CTGTGTGCATGGAGCTGGGCAGG - Intergenic
1175461581 20:59155667-59155689 CTGAGTGTAGGAAGGAGAGAAGG + Intergenic
1175549356 20:59806655-59806677 CTGTGTGTATGTGGGTGGGGGGG - Intronic
1175932789 20:62500830-62500852 GTTTGTGTGTGCAGGTGAGAGGG + Intergenic
1176002639 20:62839853-62839875 GTGTGTGCGTGGAGGGGAGAAGG - Intronic
1176111557 20:63413241-63413263 CGGTGTGGATGGGGGAGAGATGG + Intronic
1176638115 21:9268160-9268182 GTGTGTCTCTGCAGGTGAGAAGG - Intergenic
1176660981 21:9634738-9634760 CTGTGTGTGTGCAGCAGAGAAGG + Intergenic
1176940288 21:14915638-14915660 GTGTGTGGATGGGGGTGGGAGGG + Intergenic
1176946603 21:14989782-14989804 ATGTGTGTGTGGAGGTGAGGAGG + Intronic
1177372923 21:20229235-20229257 CTGTGTCTATGGGTGAGAGAGGG + Intergenic
1177428814 21:20962004-20962026 CAGTGTGGATAGAGGTGACAAGG - Intergenic
1178116864 21:29426843-29426865 CTCTTTGTCTGGAGGGGAGAAGG - Intronic
1178295432 21:31405829-31405851 GTGTGTGTTGGGAGGTGATATGG - Intronic
1179022792 21:37655530-37655552 GTGTGTGTATGTATTTGAGAAGG + Intronic
1179092009 21:38275018-38275040 CAGAGTGTATTGAGGTGACATGG - Intronic
1179123941 21:38575064-38575086 CTGAGGCTCTGGAGGTGAGAGGG - Intronic
1180422155 22:12875657-12875679 GTGTGTCTCTGCAGGTGAGAAGG - Intergenic
1180480297 22:15748131-15748153 CAGTGTGTGTGGTGGTGTGATGG - Intergenic
1180502106 22:15939344-15939366 ATGTGTCTCTGCAGGTGAGATGG - Intergenic
1180596455 22:16977275-16977297 CTGTGTCTTTGCACGTGAGATGG - Intronic
1180620283 22:17157071-17157093 GTGTGTGTATGTGTGTGAGACGG - Intronic
1181972995 22:26707337-26707359 CTGTGTGTATAATGGTGAGTGGG + Intergenic
1182072851 22:27475725-27475747 CAGTGTGTGGGGAGGTGAGAGGG + Intergenic
1182167793 22:28193540-28193562 GTGTGTGTCTGCACGTGAGATGG - Intronic
1182169401 22:28211386-28211408 GTGTGTGTCTGCATGTGAGATGG - Intronic
1182623289 22:31629509-31629531 GGGTGTGTATGTAGGTGCGAGGG + Intronic
1182966271 22:34524343-34524365 CTGTGTGTATATATGTGTGATGG - Intergenic
1183964615 22:41434341-41434363 CTGTGTGTGTGGATGGGAGGAGG + Exonic
1184450759 22:44581204-44581226 CCGTGTGAATAGAGGAGAGATGG + Intergenic
949151591 3:774620-774642 CTGTGTGTTTGGAGGTGATAGGG - Intergenic
949369968 3:3324297-3324319 CTGTGTGTATGGCTGTGACATGG - Intergenic
950619469 3:14192665-14192687 GTGTGTGTTTGCATGTGAGATGG + Intronic
951175486 3:19594150-19594172 TTGTGTGTGTGCACGTGAGATGG + Intergenic
951272254 3:20640542-20640564 CTGTGTGTATGTGTATGAGAAGG - Intergenic
951299295 3:20974731-20974753 CTGTGTGTTTGGGGGTGTGGTGG - Intergenic
951490548 3:23266034-23266056 GTGTGTGTCTGCACGTGAGATGG + Intronic
951532702 3:23712651-23712673 CTGTGTGAGTCGAGGAGAGATGG + Intergenic
951931225 3:27969178-27969200 CTGTGTGGTTGGAGCAGAGAGGG - Intergenic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952448539 3:33408370-33408392 GTGTGTGTGTGAAGGAGAGAGGG + Intronic
952819928 3:37477496-37477518 CAGTGTCCATGGAGCTGAGATGG - Intronic
953076810 3:39579139-39579161 CAGACTGTATAGAGGTGAGAAGG + Intergenic
954454131 3:50587922-50587944 CTGAGGGTTTGGATGTGAGATGG + Intergenic
954548351 3:51458167-51458189 GTGTGTGTCTGCATGTGAGATGG - Intronic
954609249 3:51935571-51935593 CTGTGAGTGTGGATGGGAGAGGG - Exonic
954640916 3:52097236-52097258 GTGTGTGTGTGGCGGGGAGAGGG + Intronic
954978805 3:54724023-54724045 ATGTGTGTCTGCACGTGAGATGG - Intronic
955002088 3:54937008-54937030 CTGTGTGTGAGGAGGTGCTAAGG + Intronic
955030445 3:55211368-55211390 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
955211698 3:56947381-56947403 ATGTGTCTCTGCAGGTGAGATGG - Intronic
955333734 3:58068409-58068431 CTGTGTGGATGGAAGGGATATGG + Intronic
955428620 3:58818394-58818416 CTGTGTCTCTGCACGTGAGATGG - Intronic
955630099 3:60964320-60964342 GTGTGTCTCTGCAGGTGAGATGG + Intronic
955670390 3:61395507-61395529 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
955916043 3:63909391-63909413 ATGTGTGTGTGGAGATGACAAGG - Intronic
956588698 3:70890459-70890481 CTGTGTTTATGGAGATCAGGTGG - Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957153416 3:76516286-76516308 GTGTGGGTATGGAGGTAGGATGG - Intronic
957209113 3:77237435-77237457 GTGTGTGTGTGGTGGTGATAAGG + Intronic
957886905 3:86299272-86299294 CTGTGTCTCTGCACGTGAGATGG - Intergenic
957908037 3:86582912-86582934 GTGTGTCTTTGCAGGTGAGATGG - Intergenic
958136883 3:89505250-89505272 CTGTTTGAATGAAGGTAAGATGG + Intergenic
958624312 3:96605227-96605249 ATGTGTCTCTGCAGGTGAGATGG + Intergenic
958833027 3:99112546-99112568 CTGTGTGTCAGGGGGTGAGAGGG + Intergenic
959428450 3:106222289-106222311 GTGTGTCTTTGCAGGTGAGATGG + Intergenic
959723749 3:109521335-109521357 CTGTGTCTCTGCATGTGAGATGG + Intergenic
959907643 3:111728413-111728435 TTGTGTGTGTGTAGGTGAGAGGG + Intronic
960363663 3:116745092-116745114 CTGTGTCTCTGCATGTGAGATGG - Intronic
960947101 3:122974286-122974308 CTGTGTGTGTGCAGGAGCGAGGG - Intronic
961243473 3:125432231-125432253 CTGTGGGCAAGGAGGTGTGAGGG - Intergenic
962254532 3:133861368-133861390 ATGTGTGTTTGGGGGTGAGGAGG + Intronic
962533073 3:136301526-136301548 CTGTGTGTGTGGAGGTCCGTGGG + Intronic
962833950 3:139170359-139170381 GTGTGTGTCTGCATGTGAGATGG + Intronic
962836545 3:139194533-139194555 ATGTGTGTCTGCACGTGAGATGG + Intronic
963032240 3:140989807-140989829 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
963209228 3:142670315-142670337 TTGTGTGACTGGAGCTGAGATGG + Intronic
963237900 3:142973726-142973748 CTATGTGTGTGCCGGTGAGACGG - Intronic
963269378 3:143270540-143270562 ATGTCTTTATGGAGGTGAGGTGG + Intronic
963431854 3:145216804-145216826 CTGTGTGTGTGGGGGTGGGAGGG + Intergenic
963456353 3:145552525-145552547 CAGACTGTATAGAGGTGAGAAGG + Intergenic
964158859 3:153621519-153621541 CTGTGTGTGTGGAAGAGAAAGGG + Intergenic
964214557 3:154264825-154264847 GTGTGTTTCTGCAGGTGAGATGG - Intergenic
964318730 3:155471180-155471202 GTGTGTGTCTGCACGTGAGATGG - Intronic
964325794 3:155544140-155544162 GTGTGTGTCTGCACGTGAGATGG - Intronic
965015335 3:163150361-163150383 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
965223784 3:165961107-165961129 GTGTGTGTCTGCATGTGAGATGG - Intergenic
965359457 3:167720053-167720075 CTGTGTTTAATGAGGTGAGTTGG - Exonic
965445407 3:168768335-168768357 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
965522468 3:169681604-169681626 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
965646018 3:170882450-170882472 GTGTGTGTCTGCACGTGAGATGG + Intergenic
965874548 3:173300416-173300438 ATGGGTGGATGGAGGTAAGAGGG + Intergenic
966227495 3:177613728-177613750 CTGTGTGAATGCAGGTAACAGGG - Intergenic
966442193 3:179958021-179958043 GTGTGTGTATGTGTGTGAGAGGG - Intronic
966488687 3:180501634-180501656 GTGTGTCTATGCATGTGAGATGG + Intergenic
967243860 3:187467605-187467627 CAGACTGTATAGAGGTGAGAAGG + Intergenic
967676513 3:192305518-192305540 GTGTGTGTCTGGAAGAGAGACGG - Intronic
967736977 3:192963516-192963538 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1202748779 3_GL000221v1_random:136861-136883 GTGTGTCTCTGCAGGTGAGAAGG + Intergenic
969221879 4:5765791-5765813 GTGTGTGTCTGCACGTGAGATGG + Intronic
969988638 4:11237345-11237367 GTGTGTGTCTGCACGTGAGATGG - Intergenic
970917685 4:21354402-21354424 GTGTGTCTCTGCAGGTGAGATGG - Intronic
972402617 4:38719368-38719390 AGGTGTGCATGGAGGTGGGAGGG + Intergenic
972790999 4:42370952-42370974 CAGTGTGTATGTATGTGGGAGGG + Intergenic
973369149 4:49231328-49231350 CTGGCTGTATGGTGGTGGGAAGG - Intergenic
973391890 4:49564088-49564110 CTGGCTGTATGGTGGTGGGAAGG + Intergenic
973654537 4:53032544-53032566 GTGTGTCTTTGCAGGTGAGATGG - Intronic
974678855 4:65135475-65135497 TTGTGTCTCTGGAGGTGAGGTGG - Intergenic
974795546 4:66744515-66744537 GTGTGTGTGTGGAGGTGGGTGGG - Intergenic
975232375 4:71949808-71949830 ATGTGTCTCTGCAGGTGAGATGG - Intergenic
976901537 4:90183262-90183284 GTGTGTGTTTGGAGGTCATAGGG - Intronic
976957067 4:90913745-90913767 CTGTGTCTCTGCACGTGAGATGG - Intronic
977276090 4:94978935-94978957 GTGTGTGTATGTATGTGTGATGG - Intronic
977478184 4:97539296-97539318 CTGTGTCTCTGCATGTGAGATGG - Intronic
977653384 4:99494367-99494389 GTGTGTGTTTGCATGTGAGATGG - Intergenic
978150508 4:105428453-105428475 CTGTGTCTCTGCACGTGAGATGG - Intronic
979177639 4:117684037-117684059 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
979967318 4:127090447-127090469 GTGTGTCTTTGGATGTGAGATGG - Intergenic
980139482 4:128897776-128897798 GTGTGTCTCTGCAGGTGAGATGG - Intronic
980171067 4:129290961-129290983 GTGTGTCTTTGGATGTGAGATGG + Intergenic
980216256 4:129856021-129856043 ATGTGTCTCTGCAGGTGAGATGG - Intergenic
980587149 4:134831903-134831925 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
980682075 4:136176557-136176579 GTGTGTGTATGGTGGTGGGGGGG - Intergenic
981149601 4:141366288-141366310 GTGTGTGTCTGCACGTGAGATGG + Intergenic
981222725 4:142255458-142255480 GTGTGTGTCTGCATGTGAGATGG - Intronic
983056228 4:163101648-163101670 CAGACTGTATGGAGGTGGGAAGG + Intergenic
983074784 4:163312739-163312761 CTGTGTGTATGGGGGTGGCAAGG - Intergenic
983310666 4:166057120-166057142 ATGTGTGTATGTATGTGAAATGG - Intronic
983976220 4:173937233-173937255 TTGTGTGTCAGGAGGTAAGAAGG - Intergenic
984062278 4:175004703-175004725 ATGTGTGCATGTATGTGAGAAGG + Intergenic
984076158 4:175182787-175182809 GTGTGTTTATGCATGTGAGATGG + Intergenic
1202753016 4_GL000008v2_random:26577-26599 GTGTGTCTCTGCAGGTGAGAAGG - Intergenic
986385868 5:7232834-7232856 GTGTGTGTCTGCACGTGAGATGG - Intergenic
986799725 5:11246705-11246727 CTGTGTGTCTGTAGGTGGGTGGG + Intronic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987424028 5:17753492-17753514 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
987591411 5:19932555-19932577 GTGTGTGTATTGTGGGGAGAGGG - Intronic
987628502 5:20435126-20435148 GTGTGTGTGTGGTGGGGAGAGGG - Intronic
988687537 5:33539581-33539603 CTGTGGGTCTTGAGTTGAGAAGG - Intronic
989234174 5:39125690-39125712 CTGTGTGGATGAGCGTGAGAGGG + Intronic
989300246 5:39882866-39882888 GTGTGTGTGTGGTGGTGGGAAGG + Intergenic
989345080 5:40421075-40421097 GTGTGTCTCTGGATGTGAGATGG + Intergenic
989583488 5:43055368-43055390 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
989627318 5:43442725-43442747 CTATGTCTCTGCAGGTGAGATGG + Intergenic
990163916 5:52974497-52974519 GTGTGTGTCTGCATGTGAGATGG + Intergenic
991000487 5:61777788-61777810 TTGTGTGTGTGGATGTGTGAGGG - Intergenic
991040121 5:62166846-62166868 CTGTGTGTGTGGAGGTGGGTGGG - Intergenic
991105679 5:62839324-62839346 GTGTGTGTCTGCACGTGAGATGG - Intergenic
991627677 5:68621106-68621128 CTGTGTGTATATAGGAGAGGAGG + Intergenic
991934979 5:71792320-71792342 GTGTGTGTTTGCATGTGAGATGG - Intergenic
992350665 5:75925513-75925535 CTATGTGTATGGAGATTGGAAGG - Intergenic
992604215 5:78439102-78439124 GTGTGTCTCTGCAGGTGAGATGG + Intronic
993403892 5:87487497-87487519 GTGTGTCTTTGCAGGTGAGATGG + Intergenic
993494214 5:88588860-88588882 GTGTGTCTTTGGATGTGAGATGG - Intergenic
993861868 5:93145987-93146009 CTGAGTGTATGCAGGGGAGCTGG - Intergenic
994538285 5:101059649-101059671 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
994580928 5:101641027-101641049 CTGTGTTTATGGAAGGGAGAGGG - Intergenic
994611065 5:102040347-102040369 TTGTGTGTATAGAGGGGAGGGGG - Intergenic
994775992 5:104035986-104036008 CAGACTGTATGGAGGTGGGAAGG - Intergenic
995296984 5:110534211-110534233 CAGACTGTATAGAGGTGAGAAGG - Intronic
995489623 5:112677387-112677409 GTGTGTCTTTGCAGGTGAGATGG + Intergenic
996119084 5:119650971-119650993 CAGTGTGAATGGAAGTCAGATGG + Intergenic
996468835 5:123835603-123835625 TTGTTTATCTGGAGGTGAGAAGG + Intergenic
996526706 5:124488131-124488153 CTGTGTGTTTGCACATGAGATGG + Intergenic
997004387 5:129801609-129801631 CTGTGTCTTTGCATGTGAGATGG + Intergenic
997089212 5:130837150-130837172 TTGTCTGTATGGAGCTTAGAAGG + Intergenic
997202786 5:132022814-132022836 CTCTGGGAATGGAGGTGAGGGGG + Intergenic
998523931 5:142825427-142825449 CTGAGGTTATGGAGATGAGAAGG + Intronic
998534233 5:142914649-142914671 CTGTGTGTAGAGGTGTGAGAGGG + Intronic
998679037 5:144444201-144444223 CTTTGTGTGTGGAGGGGGGAGGG - Intronic
999054320 5:148557484-148557506 ATGTGTGTCTGGAGCTCAGAGGG + Intronic
999475938 5:151899022-151899044 GTGTGTGTATGAAGGAGGGAGGG + Intronic
1000015925 5:157276367-157276389 CTGTGTGTATTGAGATGATATGG + Intronic
1000406709 5:160895307-160895329 GTGTGTCTTTGCAGGTGAGATGG - Intergenic
1000724248 5:164749317-164749339 CTCTGAGTAAGGAGGAGAGAAGG - Intergenic
1001153389 5:169251932-169251954 CTGTTTTTGTGGCGGTGAGATGG - Intronic
1001304667 5:170563011-170563033 GTGTGTGGGTGGAGGTGAGGAGG - Intronic
1001372398 5:171218788-171218810 CTGTGTTTTTGCATGTGAGATGG + Intronic
1001750428 5:174126064-174126086 GTGTGTGTGTGGATGGGAGATGG - Intronic
1001930852 5:175672054-175672076 GTGTGTGTGTGGAGGGGTGAAGG - Intronic
1002346092 5:178548062-178548084 GTGTGTGTGTGGGGGTGAGGGGG - Intronic
1002826365 6:777713-777735 CTGTGTGGAGGGATGGGAGAGGG + Intergenic
1003297870 6:4849857-4849879 CAGTGTGTTTGATGGTGAGATGG + Intronic
1003413758 6:5890040-5890062 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1003802289 6:9683887-9683909 GTGTGTCTCTGCAGGTGAGATGG - Intronic
1004164016 6:13239825-13239847 CTGTGTGTCAGGAGGAGAGGAGG + Intronic
1004771292 6:18785553-18785575 CTGTGTGTATGTAGGTATGGGGG - Intergenic
1004819786 6:19354927-19354949 CTGTGTGTATGTTGGTGTGCTGG - Intergenic
1004831746 6:19483978-19484000 GTGTGTGTCTGCACGTGAGATGG - Intergenic
1005097325 6:22131720-22131742 CTGTTTGTTTACAGGTGAGATGG - Intergenic
1005198809 6:23319558-23319580 CTGTGTGTCTGGAGCTGAAGGGG + Intergenic
1005202478 6:23362860-23362882 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1005239376 6:23806168-23806190 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
1005446486 6:25929435-25929457 CTGTATTTATGGATCTGAGAGGG - Intronic
1005519324 6:26584739-26584761 CTTTGTGTGTGTACGTGAGATGG - Intergenic
1005729322 6:28681845-28681867 CTATGTGTAGGGTGGGGAGATGG - Intergenic
1006337274 6:33427390-33427412 GTGTGTGTTTGGAGTTGAGGTGG + Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1007098811 6:39230607-39230629 GTGTGTGTGTGGCGGGGAGAGGG - Intergenic
1007107931 6:39296068-39296090 GTGTGTGTATGTAACTGAGAGGG + Intergenic
1007300529 6:40864675-40864697 CAGAGTGTATAGAGGTGGGAAGG + Intergenic
1007909467 6:45499047-45499069 GTGTGGGTATGGAGGAGAGTGGG + Intronic
1008042758 6:46819202-46819224 GTGGGTTTGTGGAGGTGAGAAGG + Intronic
1008802837 6:55390881-55390903 GTGTGTGTATGTGTGTGAGATGG - Intronic
1008963455 6:57290055-57290077 GTGTGTGTTTGCATGTGAGACGG - Intergenic
1009238965 6:61161462-61161484 GTGTGTCTCTGGACGTGAGATGG + Intergenic
1009430349 6:63559021-63559043 TTGACTGTATGGAGGCGAGAAGG + Intronic
1009529230 6:64788619-64788641 TTGTGTGGATGGAGCTGAAACGG - Intronic
1009987924 6:70804380-70804402 GTGTGTCTCTGCAGGTGAGATGG + Intronic
1010695916 6:78973631-78973653 GTGTGTCTCTGCAGGTGAGATGG - Intronic
1010994237 6:82514515-82514537 ATGTGTGTTTGCATGTGAGATGG - Intergenic
1011105921 6:83781429-83781451 CTTGGTGTAAGGAAGTGAGATGG + Intergenic
1011130089 6:84043641-84043663 GTGTGTGTATGGGGGGGTGAGGG + Intronic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1011339274 6:86294755-86294777 CTGTGTGTAGAGAAGTCAGAAGG - Intergenic
1011926780 6:92655033-92655055 GTGTGTCTGTGCAGGTGAGATGG + Intergenic
1012247043 6:96937717-96937739 CTGTGAGGATGGAGGGTAGAGGG - Intronic
1012882033 6:104801959-104801981 GTGTGTTTCTGCAGGTGAGATGG - Intronic
1013383581 6:109601963-109601985 GTGTGTGTCTGCACGTGAGATGG + Intronic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1013874167 6:114803796-114803818 GTGTGTGTCTGCAGGTGAGATGG + Intergenic
1014564586 6:122932065-122932087 GTGTGTGTGTTGTGGTGAGAGGG + Intergenic
1014757044 6:125312880-125312902 CTGTGTGTGTGCATGTTAGAGGG - Intergenic
1014903778 6:127002020-127002042 CTGTGTGTTGGGGGGTGAGTGGG - Intergenic
1014909237 6:127069967-127069989 CTTTTTGTATAGTGGTGAGATGG - Intergenic
1015847924 6:137540706-137540728 CTGTGTGTAGGAAGGAGAGGAGG + Intergenic
1015863602 6:137705713-137705735 CTGTGTGGATGGTTTTGAGAAGG + Intergenic
1015931492 6:138364919-138364941 GTGTGTGTCTGCATGTGAGATGG - Intergenic
1016142005 6:140624569-140624591 GTGTGTATATGTATGTGAGATGG + Intergenic
1016394939 6:143613836-143613858 CTTTGTGTGTGGAGGTGGGTTGG - Intronic
1016403269 6:143703226-143703248 CTGGGGGAATAGAGGTGAGAGGG + Intronic
1016460777 6:144278596-144278618 CTCTCTGTATTGAGGAGAGATGG - Intergenic
1016807431 6:148226040-148226062 CATTATGTATGGAGATGAGAGGG - Intergenic
1017062116 6:150493564-150493586 GTGTGTGTGTAGAGGGGAGAGGG + Intergenic
1017680668 6:156861169-156861191 CTGTGTGTTTGGTGGTGGGGAGG + Intronic
1017818394 6:158031342-158031364 CTCTGTGGCTGGAGGTGTGAGGG + Intronic
1017964859 6:159255316-159255338 CTGTGTGGTAGGAGGTGGGATGG - Intronic
1018880353 6:167872521-167872543 CTGTGTGGAGGGAGGATAGAGGG + Intronic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1020640629 7:10749324-10749346 ATGTGTGTCTGCACGTGAGATGG - Intergenic
1020877674 7:13718511-13718533 GTGTGTGTGTGGTGGGGAGAAGG + Intergenic
1020890283 7:13869592-13869614 CTGTGTGTATAGATGTGAAGAGG - Intergenic
1021282490 7:18738147-18738169 GTGTGTCTCTGCAGGTGAGATGG + Intronic
1021856124 7:24858390-24858412 TTGAATGTATGGAAGTGAGAAGG + Intronic
1022067455 7:26874022-26874044 TTGTGTGTATGGGAATGAGATGG - Intronic
1022691536 7:32660955-32660977 CTGTATGCATTGGGGTGAGAGGG - Intergenic
1023385704 7:39655400-39655422 ATCAGTGTATGGAGGGGAGATGG + Intronic
1023674716 7:42617470-42617492 CTGTGTGCAAGCAGGAGAGAGGG - Intergenic
1024246265 7:47472575-47472597 CTGTGTGTAGGGAGCTGCCAGGG - Intronic
1024552430 7:50574721-50574743 GTGTGTCTCTGGACGTGAGATGG + Intergenic
1024738833 7:52334265-52334287 TGGTCTGTATAGAGGTGAGAAGG + Intergenic
1024863940 7:53881112-53881134 CAGTGTTTATGGAGCTGAGTAGG - Intergenic
1024950285 7:54853904-54853926 CTGTGTCTTTGCACGTGAGATGG + Intergenic
1026026523 7:66749099-66749121 ATCTCTGTATGGAGGTGAGGTGG - Intronic
1026383349 7:69821143-69821165 CTGTGTGTATACTGGAGAGAGGG + Intronic
1026734604 7:72941864-72941886 GGGTGTCTTTGGAGGTGAGAGGG - Exonic
1026784939 7:73296776-73296798 GGGTGTCTTTGGAGGTGAGAGGG - Intergenic
1026975644 7:74496254-74496276 ATGTGTGTATGCATGTGAGTGGG + Intronic
1027026075 7:74852501-74852523 CTATGTGTGTTGAGGGGAGATGG + Intergenic
1027061681 7:75091618-75091640 CTATGTGTGTTGAGGGGAGATGG - Intergenic
1027109138 7:75423154-75423176 GGGTGTCTTTGGAGGTGAGAGGG + Exonic
1027629527 7:80585313-80585335 GTGTGTGTGTGGAGGTGGGGGGG + Intronic
1027929851 7:84518614-84518636 GTGTGTCTATGCACGTGAGATGG - Intergenic
1027964762 7:84991332-84991354 GTGTGTCTATGCACGTGAGATGG + Intergenic
1028382110 7:90211640-90211662 CTGTGTGGAGGGAGCTGGGAAGG - Intronic
1030110365 7:106021614-106021636 GTGTGTGTTTGGGGGTGTGATGG + Intronic
1030112469 7:106038495-106038517 GTGTGTGTGTGGTGGTGAGTGGG + Intergenic
1030395538 7:108981579-108981601 CTGTGTATGTGGAGGTGGGGTGG + Intergenic
1031144051 7:117978229-117978251 TTGTGTGTGTGGATGTGTGAGGG - Intergenic
1031256876 7:119463806-119463828 GTGTGTCTCTGGATGTGAGATGG - Intergenic
1031314403 7:120238717-120238739 CTGTGTCTCTGCACGTGAGATGG + Intergenic
1031382523 7:121105101-121105123 CTGATTGTATTGATGTGAGAGGG - Intronic
1031401420 7:121329386-121329408 ATGTGAGTATGGAGGTGGCAGGG + Exonic
1031803486 7:126278063-126278085 ATGTGTGTCTGCACGTGAGATGG + Intergenic
1032417449 7:131747319-131747341 GTGTGTGTATGGAGGGGTGGGGG + Intergenic
1032502013 7:132406793-132406815 CTCTGTGAATGAAGGTAAGAAGG + Intronic
1032896502 7:136256869-136256891 CTCTGTAGATGGAGGTGAGAAGG + Intergenic
1033273476 7:139953687-139953709 CTGGGTCTGTGGAGGTCAGAGGG - Intronic
1033858966 7:145600878-145600900 CTGGCTTTATGGAGGTCAGAAGG - Intergenic
1033953982 7:146821052-146821074 GTGTGTGTCTGCACGTGAGATGG + Intronic
1033976961 7:147114697-147114719 GTGTGTGTTTGCATGTGAGATGG + Intronic
1034077760 7:148249230-148249252 CAGTGGGTTTGGTGGTGAGAAGG - Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034480053 7:151312814-151312836 CTGTGTGTATGAATGTGTGGGGG + Intergenic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034999934 7:155604399-155604421 CTCTGAGGATGGAGGTGAGAGGG + Intergenic
1035155942 7:156913276-156913298 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1035182934 7:157103742-157103764 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1035882028 8:3253762-3253784 GTGTGTCTCTGCAGGTGAGATGG + Intronic
1036125391 8:6057452-6057474 CTGTGTGTGTGGTGGTGCAAGGG - Intergenic
1036281792 8:7406805-7406827 CAGACTGTATGGAGGTGGGAAGG - Intergenic
1036339679 8:7904766-7904788 CAGACTGTATGGAGGTGGGAAGG + Intergenic
1037159171 8:15746339-15746361 GTGTGTGTATGAAAGTGAGCTGG + Intronic
1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG + Intronic
1038366266 8:26938825-26938847 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1038997592 8:32942350-32942372 CTGTATCTATTGAGGTGATATGG + Intergenic
1039143464 8:34419355-34419377 ATGTGTGTGTGTAGGGGAGAGGG + Intergenic
1039899248 8:41739651-41739673 TTGTCAGCATGGAGGTGAGAAGG + Intronic
1040694646 8:49980986-49981008 CTGTGTGCATGGGGCTCAGAAGG - Intronic
1040890107 8:52308659-52308681 CTGTGTCCAGGGAGGTGAGTGGG + Intronic
1041714119 8:60918195-60918217 GTGTGTGTATGGTGGGGAGGGGG + Intergenic
1042073082 8:64957803-64957825 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
1042129036 8:65568347-65568369 CTGTGGGAATGGAAGTGGGAAGG - Intergenic
1042332327 8:67593771-67593793 ATGTGTGTCTGCACGTGAGATGG + Intronic
1042394719 8:68278539-68278561 ATGTGTGTCTGCACGTGAGATGG - Intergenic
1042465506 8:69125877-69125899 GTGTGTCTATGCAGGTGAGATGG - Intergenic
1042656661 8:71106207-71106229 CTGTATGTAAGGGGGTGAGAGGG - Intergenic
1042989808 8:74626441-74626463 CTCTGTGGATGGAAGTAAGAGGG + Intronic
1043440974 8:80276830-80276852 GTGTGTGTGTGTATGTGAGATGG - Intergenic
1044225211 8:89710427-89710449 GTGTGTGTCTGCATGTGAGATGG - Intergenic
1044253139 8:90027606-90027628 GTGTGTCTCTGCAGGTGAGATGG + Intronic
1044305820 8:90639373-90639395 CTGTGTGTATGTGGGTGGGAGGG - Intronic
1044429878 8:92095942-92095964 CTGTTTGGATGGAGGTGAGATGG - Intronic
1044902835 8:96966930-96966952 ATGTGTGTATGTATGTGTGAAGG - Intronic
1045293639 8:100854557-100854579 GTGTGTGTCTGCATGTGAGATGG - Intergenic
1045587029 8:103549724-103549746 GTGTGTCTATGCATGTGAGATGG - Intronic
1046619207 8:116510150-116510172 GTGTGTGTATGTGGGAGAGAGGG - Intergenic
1046828805 8:118721604-118721626 ATGTGTGTCTGCACGTGAGATGG + Intergenic
1047021024 8:120775171-120775193 CTTTGTGTTTTGAGGGGAGAAGG + Intronic
1047592707 8:126343701-126343723 GTGTGTGTCTGCACGTGAGATGG - Intergenic
1047599472 8:126411733-126411755 GTGTGTGTATGGGGGATAGAGGG + Intergenic
1048141646 8:131800882-131800904 GTGGGTGTATGGAGGTGGGACGG + Intergenic
1048696931 8:137038854-137038876 CTGTGTCTCTGCATGTGAGATGG + Intergenic
1048815788 8:138332572-138332594 TTGCTTGAATGGAGGTGAGATGG - Intronic
1049456093 8:142690103-142690125 GTGTGTGTGTGGAGGGGAGGCGG + Intergenic
1049638846 8:143705328-143705350 CTGTGTGTAGGGAGGTGCACGGG + Intronic
1049763658 8:144342997-144343019 CTGTGTCTCTGTAGGTGAGTGGG - Intergenic
1049845212 8:144797485-144797507 AAGTGTGTGTGGAGGTGAGTGGG + Intergenic
1050645527 9:7715154-7715176 GTGTGTCTTTGCAGGTGAGATGG - Intergenic
1050728623 9:8681550-8681572 GTGTGTGTATGGAGATGGGGAGG - Intronic
1051760744 9:20461023-20461045 ATGTGTGGATGGAGAGGAGAAGG - Intronic
1051836394 9:21342952-21342974 GTGTGTCTTTGCAGGTGAGATGG + Intergenic
1051959303 9:22738668-22738690 GTGTGTGTCTGCACGTGAGATGG + Intergenic
1052074770 9:24127581-24127603 CTGTGTGTACTGGGGTGAAAAGG + Intergenic
1052197894 9:25740373-25740395 GTGTGTGTATGGAGTGGAGAGGG + Intergenic
1052513669 9:29452825-29452847 ATGTGTGTCTGCATGTGAGATGG - Intergenic
1052717173 9:32130749-32130771 ATGTGTGTCTGCATGTGAGATGG - Intergenic
1053109581 9:35446226-35446248 CTCTCAGTATTGAGGTGAGATGG - Intergenic
1053189565 9:36050905-36050927 ATGTGTGTGTGGAAGTGAGTGGG - Intronic
1053202856 9:36164597-36164619 GTGTGTGTATGGGGGTGGGGGGG - Intergenic
1053345780 9:37377300-37377322 GTGTGTGTGTGTAGGAGAGAAGG + Intergenic
1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053827290 9:42038383-42038405 GTGTGTCTCTGCAGGTGAGATGG - Intronic
1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1054603271 9:67149057-67149079 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1055758458 9:79580973-79580995 CTATGTGTGTGGGGGTGGGAAGG + Intronic
1056102928 9:83317179-83317201 GTGTGTGTATGCATGAGAGACGG - Intronic
1056404227 9:86258810-86258832 CTGTGTGTATGGTGCAGAGAAGG - Intronic
1056715950 9:89028192-89028214 TTGTGTGTGTGGAGGTGATGTGG - Intronic
1057730412 9:97603387-97603409 GTGTGAGTATGAAGGAGAGAGGG - Intronic
1058305614 9:103437479-103437501 GTGTGTGTCTGCATGTGAGATGG + Intergenic
1058577616 9:106420716-106420738 CTGTGTGTACAGTGGTGATAGGG - Intergenic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059510328 9:114839391-114839413 CTGTCTGTGTGGAGGCCAGAGGG + Intergenic
1059783564 9:117555644-117555666 CTGTGTGTATTGAGGTGGATAGG + Intergenic
1059904302 9:118964691-118964713 ATGTGTGAAAGAAGGTGAGATGG - Intergenic
1060200474 9:121649392-121649414 GAGTGTGTGTGGAGGGGAGAGGG - Intronic
1061008270 9:127940775-127940797 CTGTCTTTAGGGAGGTGATAAGG - Exonic
1061821465 9:133229163-133229185 CTCTGTGTGTGGAGCAGAGAGGG - Intergenic
1061833973 9:133317200-133317222 CTCTGTGTGTGGAGCAGAGAGGG + Intergenic
1061892848 9:133631854-133631876 CCCTGTGTATGGAGGAGAGATGG + Intergenic
1062031164 9:134362667-134362689 GTGTGTGTCTGTAGGTGTGAAGG - Intronic
1062237781 9:135520901-135520923 CTCTGTGTGTGGAGCAGAGAGGG + Intergenic
1062296859 9:135835232-135835254 CTGTGTGTGTGGGGGCGGGAGGG - Intronic
1062557798 9:137123496-137123518 CTGTGTTTTTGGGGGTCAGATGG + Intergenic
1203354142 Un_KI270442v1:115711-115733 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
1203717420 Un_KI270742v1:166951-166973 GTGTGTCTCTGCAGGTGAGAAGG + Intergenic
1203533806 Un_KI270743v1:11282-11304 GTGTGTCTCTGCAGGTGAGAAGG - Intergenic
1203638550 Un_KI270750v1:136582-136604 CTGTGTGTGTGCAGCAGAGAAGG + Intergenic
1186045341 X:5530518-5530540 GTGTGTGTATGTAATTGAGAAGG - Intergenic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1187225901 X:17375350-17375372 CTGTGTGTGTGTGGGTGAGTGGG - Intergenic
1187354082 X:18550333-18550355 CTGTGGGTATGGATGTGGGTGGG - Intronic
1187414462 X:19081223-19081245 CTGTGGGTGTGGGGGTGAGGTGG - Intronic
1188048402 X:25454491-25454513 CTGTGTGTTTGGTGAGGAGATGG - Intergenic
1188623542 X:32256400-32256422 GTGTGTGTTTGCATGTGAGATGG + Intronic
1189021164 X:37342266-37342288 GTGTGTGTATGGTGGTGTGGTGG + Intergenic
1189039542 X:37528350-37528372 GTGTGTCTTTGCAGGTGAGATGG + Intronic
1189499184 X:41539111-41539133 CTGTGTGTGTGGGAGTTAGAGGG + Intronic
1189590857 X:42509268-42509290 GTGTGTCTATGTATGTGAGATGG - Intergenic
1189847308 X:45149343-45149365 CTGTGACTGTGCAGGTGAGAAGG + Exonic
1190420817 X:50282495-50282517 CAGTGTGTATGTAGGGGACATGG + Intronic
1190508638 X:51154685-51154707 CCGTGTGTATGGTGGGGATAAGG + Intergenic
1190720956 X:53147221-53147243 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
1190905164 X:54720268-54720290 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1190923551 X:54880951-54880973 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1191027668 X:55932256-55932278 GTGTGTGTTTGCATGTGAGATGG + Intergenic
1191589708 X:62869105-62869127 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1191649530 X:63521367-63521389 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
1191716160 X:64195149-64195171 GTGTGTATTTGGAGGTGGGAGGG - Intronic
1191848298 X:65566697-65566719 GTGTGTGTTTGCACGTGAGATGG + Intergenic
1192146839 X:68688110-68688132 GTGTATGTATGGAGGGGAAAGGG + Intronic
1192214345 X:69148049-69148071 CTTTGTTTATGAAGGTGGGATGG + Intergenic
1192524778 X:71832197-71832219 GTGTGTCTTTGCAGGTGAGATGG - Intergenic
1193034694 X:76936479-76936501 ATGTGTGTCTGCACGTGAGATGG - Intergenic
1193315855 X:80064433-80064455 ATGTGTCTCTGCAGGTGAGATGG + Intergenic
1193341093 X:80350536-80350558 CTGTGTCTTTGCACGTGAGATGG + Intronic
1193461275 X:81793316-81793338 CTGTGTCTCTGCACGTGAGATGG - Intergenic
1193510237 X:82390335-82390357 GTGTGTCTTTGCAGGTGAGATGG - Intergenic
1193844615 X:86453699-86453721 GTGTGTCTTTGCAGGTGAGATGG + Intronic
1194873383 X:99160021-99160043 CAGAGTGTATAGAGGTGGGAAGG + Intergenic
1194976890 X:100405559-100405581 GTGTGTGTATGGGGGGGGGAGGG - Intronic
1195063139 X:101216043-101216065 TTGTGTGTGTGTACGTGAGATGG + Intergenic
1195391211 X:104364528-104364550 CTGTGTCTCTGCATGTGAGATGG + Intergenic
1195565288 X:106333054-106333076 CTGGGTGTAAGAAGGTGATATGG + Intergenic
1196025134 X:111034027-111034049 TTGTGTGTATGGCAGGGAGAGGG - Intronic
1196160568 X:112478117-112478139 GTGTGTGTGTGAAGGTGAAAAGG + Intergenic
1196482675 X:116167795-116167817 GTGTGTGGGTGGAGGTGAGGCGG + Intergenic
1196946355 X:120830946-120830968 ATGTGTGTCTGCATGTGAGATGG + Intergenic
1197239477 X:124108289-124108311 GTGTGTGTCTGCATGTGAGATGG + Intronic
1197422558 X:126256968-126256990 CTGTGTCATTGGATGTGAGATGG + Intergenic
1197471324 X:126867661-126867683 CGGACTGTATAGAGGTGAGAAGG - Intergenic
1198595242 X:138228990-138229012 TTGTGTGTGTGGAGGTGAAGAGG - Intergenic
1198643412 X:138780418-138780440 GTGTGTCTCTGCAGGTGAGATGG - Intronic
1198882310 X:141294879-141294901 CTCTGTGTATGGGGGTCAGCTGG - Intergenic
1199178984 X:144829788-144829810 CTCTGTGCATGCAGGAGAGAAGG + Intergenic
1199530518 X:148842169-148842191 CTGTGTGGATGGAAGAGAAATGG - Intronic
1199872940 X:151914007-151914029 CAGTGTGGATGGGGGTGGGAGGG - Intronic
1199873467 X:151916051-151916073 CAGTGTGGATGGGGGTGGGAGGG - Intronic
1199874173 X:151918770-151918792 CAGTGTGGATGGGGGTGGGAGGG - Intronic
1200111926 X:153744784-153744806 CTGTGGGTCTCGAGGAGAGATGG + Intergenic
1200397326 X:155998941-155998963 CTGGGAGTCTGGAGGTGAGACGG - Intronic
1200581210 Y:4952802-4952824 ATGTGTGTCTGCACGTGAGATGG + Intergenic
1200693433 Y:6332229-6332251 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
1200787029 Y:7269956-7269978 CTGTGTGTGTGTGTGTGAGATGG + Intergenic
1201013243 Y:9571695-9571717 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1201041842 Y:9842497-9842519 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1201171578 Y:11271887-11271909 GTGTGTCTCTGCAGGTGAGAAGG + Intergenic
1201450315 Y:14104381-14104403 CTGTGTCTCTGCACGTGAGATGG - Intergenic
1201462482 Y:14241564-14241586 ATGTGTCTTTGGATGTGAGATGG - Intergenic
1201590877 Y:15613123-15613145 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
1201988091 Y:19991753-19991775 CTGTGTCTCTGAAGGTGAGTTGG + Intergenic