ID: 1186659461

View in Genome Browser
Species Human (GRCh38)
Location X:11654336-11654358
Sequence CTGTAGAAGTGGACAGCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186659461_1186659463 2 Left 1186659461 X:11654336-11654358 CCATGAGCTGTCCACTTCTACAG 0: 1
1: 0
2: 0
3: 13
4: 161
Right 1186659463 X:11654361-11654383 ATGAAAACATGTTATTTTCTTGG 0: 1
1: 0
2: 8
3: 76
4: 750

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186659461 Original CRISPR CTGTAGAAGTGGACAGCTCA TGG (reversed) Intronic
900518179 1:3093079-3093101 CAGGAGAAGCGGTCAGCTCAGGG - Intronic
901045208 1:6392159-6392181 CTGTAGATGTTGACATCTCCAGG - Intronic
903337290 1:22633618-22633640 CTGTTGAAGTGGGCAGATGAAGG - Intergenic
905775780 1:40666231-40666253 CTCTAGAAGTAGAGAGCGCAGGG - Intergenic
905867665 1:41385037-41385059 CTATGCAAGTGGACACCTCAGGG - Intergenic
907160401 1:52365333-52365355 CTGAAGAAGGGGTCACCTCAGGG - Intronic
908019992 1:59889369-59889391 CTGCAAAAGTGGAGTGCTCATGG - Intergenic
908545980 1:65162540-65162562 CTTTAAAAGTGTACAACTCAGGG + Intronic
908766413 1:67558636-67558658 CTGAAGGAGTGGACAGTTAAAGG + Intergenic
912070289 1:105800940-105800962 CTGCAGGAGTGGAGACCTCATGG - Intergenic
912565456 1:110584403-110584425 CTGTAGAACTGGAAAGAACATGG + Intergenic
913018570 1:114764199-114764221 CTGTAGAGGTGGAGCCCTCATGG + Intergenic
916370874 1:164092883-164092905 CTGCAGGAGTGGAGACCTCATGG - Intergenic
920840895 1:209552905-209552927 CTGGAAAAGTGGACAGCACCAGG + Intergenic
921341685 1:214140404-214140426 ATGTAGTAGTGGACTGCTCGGGG + Intergenic
923463342 1:234226594-234226616 CCTAAGCAGTGGACAGCTCATGG + Intronic
923506577 1:234610158-234610180 CTGTAGAAGTGGAGCGGTCGCGG - Intergenic
1064152926 10:12880123-12880145 CTTTGGAAGCAGACAGCTCAAGG + Intergenic
1064776004 10:18778009-18778031 TTCTAGAAATGGAAAGCTCATGG - Intergenic
1065978316 10:30863836-30863858 CGGTGGAAGTGGAGAGCACAAGG - Intronic
1066041002 10:31548034-31548056 CTGTAGAGGTGGAGCACTCATGG + Intergenic
1066214374 10:33272185-33272207 TAGTAAAAGTGGACAGCTTAAGG + Intronic
1072264637 10:93715341-93715363 AAGGAGAAGTGGACAGCTAATGG - Intergenic
1075230018 10:120668230-120668252 CTGTGGAAGTGGACAAAGCAAGG - Intergenic
1075835890 10:125452438-125452460 CTGCAGAAGCTGACTGCTCAGGG - Intergenic
1076408760 10:130231272-130231294 CTGCAGAAGTGGACACTGCAAGG - Intergenic
1076998411 11:310598-310620 CTGCAGATGTGGGCAGCTCAGGG + Intronic
1077000332 11:319161-319183 CTGCAGATGTGGGCAGCTCAGGG - Intergenic
1080582894 11:33658074-33658096 CTGTAGACGTGGGCATCTCCTGG - Intronic
1082759970 11:57117796-57117818 CTGTAGGAGCAGCCAGCTCATGG + Intergenic
1083897338 11:65626574-65626596 CTTTAGAAGGGCCCAGCTCACGG + Intronic
1085016199 11:73175648-73175670 CTGTAGAAGTGGGCAGACCTGGG - Intergenic
1086410205 11:86537600-86537622 CTGCAGAAATGCAGAGCTCAAGG + Intronic
1086769555 11:90745078-90745100 CTGTAGGAGTGGAGCCCTCATGG + Intergenic
1086828860 11:91534526-91534548 CTGCAGGAGTGGAGACCTCATGG + Intergenic
1088447694 11:109949975-109949997 CTGCAGAGGTGGAGACCTCATGG - Intergenic
1092283321 12:7113843-7113865 GTGGAGATGTGGACAGCCCAGGG + Intergenic
1095653376 12:44640407-44640429 TTGTAGAGATGGACAGATCAGGG - Intronic
1097983427 12:65757619-65757641 CAGTAGAAGGGGAGAACTCAGGG - Intergenic
1098715192 12:73821358-73821380 CTGTAGGAGTGGAGCCCTCATGG - Intergenic
1099487777 12:83249485-83249507 CTGCAGGGGTGGAGAGCTCATGG + Intergenic
1110365632 13:74681907-74681929 CTGCAGAAGATAACAGCTCAGGG - Intergenic
1113556612 13:111240687-111240709 CTGTAGCAGTGGACAGGGAAGGG + Intronic
1114326049 14:21589794-21589816 CTGTAGAAGGGTGCATCTCATGG - Intergenic
1117512256 14:56464602-56464624 ATTTAGAAGTGGACACCACATGG + Intergenic
1120494207 14:85213926-85213948 CTGTACAAGTTGACAACCCATGG + Intergenic
1126028902 15:44476921-44476943 CAGTAGAAGTGCACAACACAAGG + Intronic
1129459173 15:75691526-75691548 CTGTTGAAGGGGACTGATCAAGG - Intronic
1133072233 16:3254320-3254342 CTGTAGAAATGGTGACCTCAAGG + Exonic
1133300923 16:4782248-4782270 CTTTAAAAGTGTACAGTTCAAGG - Intronic
1135089706 16:19503588-19503610 TTGAAGAAGTGGTCAGCTAAAGG - Exonic
1135178857 16:20255586-20255608 CTGTGGAAGCGATCAGCTCATGG + Intergenic
1140796314 16:78441609-78441631 CTTTAGAGGTAGACAGCTCTCGG + Intronic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1144079042 17:11745388-11745410 CTGTAGATGTGGCCAGATCTTGG - Intronic
1145068506 17:19781956-19781978 CAGCAGATGTGCACAGCTCAGGG + Exonic
1145243416 17:21252700-21252722 CCGCAGAAGGGGACAGGTCACGG + Intronic
1145973397 17:28970086-28970108 CTGCTGAAGTGCCCAGCTCAGGG - Intronic
1146468650 17:33107210-33107232 CTGTAGAAGTGCAGATTTCATGG - Intronic
1148359279 17:46998528-46998550 CTGCAGAAGCCGACAGCTCTGGG - Intronic
1150426650 17:65082492-65082514 CTGTAGGAGTGGCCACCTCATGG + Intergenic
1150915333 17:69430818-69430840 ATGTAGAAGTCCAGAGCTCAGGG - Intronic
1157572702 18:48723573-48723595 CTGGAGTGGTGGGCAGCTCAGGG + Intronic
1159083449 18:63760884-63760906 CTGTAGGAGTGGTCCTCTCATGG + Intronic
1161355638 19:3818113-3818135 CTGTCTAAGTGCACAGTTCAGGG - Intronic
1161525132 19:4749763-4749785 CTGTAGAAAAGGACAGGACACGG + Intergenic
1162352765 19:10160977-10160999 CTGTGTAAGTGGACACCTCAAGG + Intronic
1163628403 19:18403834-18403856 CTGGGAAAGGGGACAGCTCAAGG + Intergenic
1163722234 19:18903785-18903807 CTGAGCAAGTGGACAGGTCAGGG - Intronic
1164417701 19:28060193-28060215 CTATAGCAGTGAACACCTCAAGG - Intergenic
1166790815 19:45397311-45397333 CAGTGGAAGTGGACATCTAAAGG - Intronic
1167644708 19:50699648-50699670 CTGGAGAATTGGAGGGCTCAGGG + Intronic
1168326400 19:55540898-55540920 CTGGAGGAGTGGACAGATGAGGG - Exonic
1168480209 19:56713714-56713736 CTGCAGTAGTTGATAGCTCAGGG + Intergenic
1168670740 19:58239311-58239333 GTGTAGAAGGGGACAGCTACTGG - Intronic
930292833 2:49517413-49517435 TTGTATAACTTGACAGCTCAGGG - Intergenic
932642123 2:73459775-73459797 TTGGAGAAATGGACAGCTCTAGG - Intronic
933472448 2:82743066-82743088 CTGGAGAAATGGAGAGTTCAAGG - Intergenic
937240382 2:120457043-120457065 CAGTAGCAGTGGAGACCTCATGG + Intergenic
939200353 2:139025945-139025967 CTATATTAGTGAACAGCTCAGGG - Intergenic
940381336 2:153018115-153018137 CTGTAGAAGTGGGGTCCTCATGG - Intergenic
943514877 2:188872385-188872407 CTGTAAAAGTGAACAGCTTGAGG + Intergenic
945644091 2:212467642-212467664 CTGTAGAGGTGGGATGCTCATGG + Intronic
946485552 2:220097723-220097745 CTGTAGTTGTGCCCAGCTCAAGG + Intergenic
946531232 2:220572483-220572505 CTGGAGATGTGGACAGAACAAGG + Intergenic
947753455 2:232544658-232544680 CTGGAGAAGTGCCCAGGTCAGGG + Intronic
1170747616 20:19114721-19114743 TTGTGGAAGTGGACATCTGAGGG - Intergenic
1171001870 20:21423238-21423260 CTGCAGAGGTGGACCCCTCAAGG - Intergenic
1171345641 20:24464232-24464254 CTGCAGTAGTGACCAGCTCAGGG + Intergenic
1173575253 20:44109140-44109162 CTGTAAAAGAGCACAGCTCTGGG + Intergenic
1177085243 21:16694992-16695014 CTGCAGAAGTGGAGCCCTCATGG - Intergenic
1177125108 21:17184563-17184585 GTGCAGAAGTGGTCAGCTGAAGG - Intergenic
1178431202 21:32520239-32520261 CTGTAGAAGAGGACAGGTGTGGG - Intergenic
1180200456 21:46220893-46220915 TTGGAGAGGTGGACAGCCCAGGG + Intronic
1183456022 22:37923842-37923864 GTCTAGAAGGGGAGAGCTCAGGG + Intronic
1184005654 22:41706556-41706578 CTGTTGAAGTGGACTGAGCATGG + Intronic
1184899071 22:47432929-47432951 CTGGAGAAGTGGGTATCTCAGGG + Intergenic
950445070 3:13032364-13032386 CTGTGAAAGTGGACAGCGCAGGG + Intronic
954442879 3:50531321-50531343 CTGAAGAAGTGAACAGACCAGGG + Intergenic
954672098 3:52296692-52296714 CTGTGGAAGTGGGGAGCTCAGGG + Intergenic
960211167 3:114968440-114968462 ATGTCCAAGTGGACAGCTGATGG + Intronic
960808937 3:121610215-121610237 CTGAAGGGGTGGAGAGCTCAAGG + Intronic
961034628 3:123634020-123634042 CTGTACCAGTGGCCAGCTAAGGG + Intronic
961178578 3:124857502-124857524 TTGTAGCAGTGGAAAGATCATGG - Intronic
962387895 3:134947601-134947623 CTGTAGAATTTTACAACTCAGGG + Intronic
965282330 3:166770059-166770081 CTGAAGGAGTTGACAGCTCCAGG - Intergenic
965554969 3:170009302-170009324 CTCCAGAAGTGGAGAGCTGAGGG + Intergenic
965774249 3:172211594-172211616 CTGTAGAAGAGGAGGGCTGATGG + Intronic
966275420 3:178159963-178159985 CTATAGAAGTTCACAGCTGAGGG + Intergenic
967535219 3:190594304-190594326 ATGTAGAGGTGGAAAGTTCAGGG + Intronic
967977013 3:195041139-195041161 CTGGAGGAGTGGGCAGCTCCCGG + Intergenic
968919063 4:3513266-3513288 ATGCTGAAGTGGAAAGCTCAGGG + Intronic
970360940 4:15308313-15308335 CTGCAGGAGTGGAGAACTCAGGG - Intergenic
977419037 4:96774149-96774171 CTCTAGAAGCTGACAGTTCAAGG - Intergenic
977675318 4:99740793-99740815 ATGTAGAAGTGGAGAGCTATGGG + Intergenic
978025784 4:103872487-103872509 CTGTTTAAGAGGACAGCTCTTGG + Intergenic
978937684 4:114398249-114398271 CTGTAGAAGAGGAAATCTAAAGG - Intergenic
979441978 4:120760955-120760977 CTGGAGAAGTGGGCAGGTGAAGG + Intronic
980828232 4:138097613-138097635 CTGTTGAAGTGAAAAGATCAAGG - Intergenic
981458529 4:144984635-144984657 CTGCATCAGTGGAAAGCTCATGG + Intronic
984047406 4:174817357-174817379 CTATGCAAGTGAACAGCTCAAGG - Intronic
984768388 4:183417450-183417472 CTGCTGAAGGAGACAGCTCAGGG + Intergenic
986072293 5:4297008-4297030 ATGAACACGTGGACAGCTCATGG - Intergenic
986473317 5:8097307-8097329 GTGTAGATGGGCACAGCTCATGG - Intergenic
986799472 5:11244824-11244846 CTGGAGAAGTGCTCAGCTCATGG + Intronic
991122549 5:63032761-63032783 CTGCAGAAGTGGAGCCCTCATGG + Intergenic
992882502 5:81124480-81124502 CTGTATAAGTGGACTCCTCTGGG + Intronic
996299169 5:121960931-121960953 CTGTAGCAGTGGACAGTCCCAGG + Intergenic
996826878 5:127692917-127692939 ATGTAAGAGTGGACAACTCAGGG + Intergenic
997114607 5:131112613-131112635 CTGTAGAAGTGGCCGACTCTGGG - Intergenic
999267962 5:150279152-150279174 CTGCCGCAGTGGACAGCTCAGGG - Intronic
1001412597 5:171521364-171521386 CTGCAGATGTAGACAGCTTAGGG + Intergenic
1001925468 5:175633014-175633036 CAGTACCAGTGGACACCTCAGGG - Intergenic
1002561085 5:180082785-180082807 CTGTAGAAGGTGACAGCCAATGG + Intergenic
1003556806 6:7147131-7147153 CTTCAGAGGTGGACAGCTCAGGG - Intronic
1004242479 6:13937671-13937693 GTGTAGAAGTAGAAAGGTCATGG + Intronic
1008078220 6:47168233-47168255 CTGTAGACGCTTACAGCTCATGG - Intergenic
1010994769 6:82520508-82520530 CAGTCCAAGTGGGCAGCTCAAGG + Intergenic
1012425830 6:99113702-99113724 CAGTAGAAGAGGACATCTCAAGG + Intergenic
1014867817 6:126553425-126553447 CTGTAGAAAGGGACAACACAAGG - Intergenic
1017237532 6:152132170-152132192 CTGATGAACTGGACACCTCAGGG - Exonic
1018646523 6:165953791-165953813 CTGTAGAACTGTACAACACAAGG - Intronic
1019429395 7:991742-991764 ATGTTGAAGTGCACAGTTCAGGG + Intergenic
1020604012 7:10312324-10312346 CTGTAAAATTGGTCAGCTCTTGG - Intergenic
1020611287 7:10401207-10401229 CTGCAGGAGTGGAGACCTCATGG - Intergenic
1022359329 7:29643554-29643576 CTGAAGAAGAGGACAGCTGTAGG - Intergenic
1023519682 7:41038117-41038139 TTGGAGAAGTGGGCAGCTCAGGG + Intergenic
1028041942 7:86063930-86063952 CTGTAGGAGTGGAATCCTCATGG + Intergenic
1029442674 7:100595763-100595785 CTGGAGAAGTGGACAGATCTGGG - Intronic
1030633994 7:111927301-111927323 CTAGAGAAGTGGTTAGCTCATGG + Intronic
1034252077 7:149700898-149700920 CTGTGGTAGTGGGCAGCTCCAGG + Intergenic
1034550093 7:151814968-151814990 ATGCAGCAGTGGACAGCTCTGGG + Intronic
1044194633 8:89359978-89360000 TTGTAAAAGTTGACAGCTTATGG - Intergenic
1047217252 8:122886423-122886445 CCATAGAACTGGACAGCACAGGG + Intronic
1051146012 9:14028039-14028061 CTGTAGAAATAGACATGTCAAGG - Intergenic
1061960512 9:133986466-133986488 GTGGAGAAGTGGACGGGTCACGG + Intronic
1062598582 9:137310097-137310119 ATGTGGAAATGGACAGGTCAGGG - Intronic
1186222737 X:7366726-7366748 CTGTAGAAGTGGTGCCCTCATGG + Intergenic
1186235220 X:7500594-7500616 CTGTTGAAGTGAACAGCTCCAGG - Intergenic
1186380184 X:9049586-9049608 CTGTAGCAGTGGATATCACAAGG - Intronic
1186405978 X:9303395-9303417 ATGTGGGAGTGGACAACTCAAGG - Intergenic
1186659461 X:11654336-11654358 CTGTAGAAGTGGACAGCTCATGG - Intronic
1190730203 X:53220875-53220897 CTGTGGAAGTGGACAACTTCAGG - Exonic
1191583797 X:62796365-62796387 ATGTACAAGTGGACATTTCAAGG - Intergenic
1192680446 X:73248274-73248296 CTGTAGGGGTGGAGTGCTCATGG + Intergenic
1195510808 X:105713288-105713310 CTGTAGGAGTGGAACCCTCATGG - Intronic
1197040747 X:121932579-121932601 CTGTAGGGGTGGACCCCTCATGG - Intergenic
1197269108 X:124406694-124406716 CTGTAAAACAGCACAGCTCAAGG - Intronic
1198367329 X:135954453-135954475 ATGTAGTAGTGGACAGCACTGGG + Intergenic
1201748073 Y:17402486-17402508 CTGTCCAAGTGGACTGGTCAGGG + Intergenic