ID: 1186661905

View in Genome Browser
Species Human (GRCh38)
Location X:11676829-11676851
Sequence GGCACCATCCGAATAGTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186661905_1186661907 7 Left 1186661905 X:11676829-11676851 CCAAGGACTATTCGGATGGTGCC No data
Right 1186661907 X:11676859-11676881 ATTTGAAATTCTTTAATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186661905 Original CRISPR GGCACCATCCGAATAGTCCT TGG (reversed) Intergenic
No off target data available for this crispr