ID: 1186669470

View in Genome Browser
Species Human (GRCh38)
Location X:11755418-11755440
Sequence GCAGAGGCCCAATTTTGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186669470_1186669475 -9 Left 1186669470 X:11755418-11755440 CCTGAACAAAATTGGGCCTCTGC No data
Right 1186669475 X:11755432-11755454 GGCCTCTGCCAGCGGGGCGGCGG No data
1186669470_1186669479 8 Left 1186669470 X:11755418-11755440 CCTGAACAAAATTGGGCCTCTGC No data
Right 1186669479 X:11755449-11755471 CGGCGGGCGACGCAACTAACTGG No data
1186669470_1186669476 -8 Left 1186669470 X:11755418-11755440 CCTGAACAAAATTGGGCCTCTGC No data
Right 1186669476 X:11755433-11755455 GCCTCTGCCAGCGGGGCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186669470 Original CRISPR GCAGAGGCCCAATTTTGTTC AGG (reversed) Intergenic