ID: 1186669475

View in Genome Browser
Species Human (GRCh38)
Location X:11755432-11755454
Sequence GGCCTCTGCCAGCGGGGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186669470_1186669475 -9 Left 1186669470 X:11755418-11755440 CCTGAACAAAATTGGGCCTCTGC No data
Right 1186669475 X:11755432-11755454 GGCCTCTGCCAGCGGGGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186669475 Original CRISPR GGCCTCTGCCAGCGGGGCGG CGG Intergenic