ID: 1186669475 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:11755432-11755454 |
| Sequence | GGCCTCTGCCAGCGGGGCGG CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1186669470_1186669475 | -9 | Left | 1186669470 | X:11755418-11755440 | CCTGAACAAAATTGGGCCTCTGC | No data | ||
| Right | 1186669475 | X:11755432-11755454 | GGCCTCTGCCAGCGGGGCGGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1186669475 | Original CRISPR | GGCCTCTGCCAGCGGGGCGG CGG | Intergenic | ||