ID: 1186669479

View in Genome Browser
Species Human (GRCh38)
Location X:11755449-11755471
Sequence CGGCGGGCGACGCAACTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186669470_1186669479 8 Left 1186669470 X:11755418-11755440 CCTGAACAAAATTGGGCCTCTGC No data
Right 1186669479 X:11755449-11755471 CGGCGGGCGACGCAACTAACTGG No data
1186669477_1186669479 -8 Left 1186669477 X:11755434-11755456 CCTCTGCCAGCGGGGCGGCGGGC No data
Right 1186669479 X:11755449-11755471 CGGCGGGCGACGCAACTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186669479 Original CRISPR CGGCGGGCGACGCAACTAAC TGG Intergenic