ID: 1186669479 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:11755449-11755471 |
| Sequence | CGGCGGGCGACGCAACTAAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1186669470_1186669479 | 8 | Left | 1186669470 | X:11755418-11755440 | CCTGAACAAAATTGGGCCTCTGC | No data | ||
| Right | 1186669479 | X:11755449-11755471 | CGGCGGGCGACGCAACTAACTGG | No data | ||||
| 1186669477_1186669479 | -8 | Left | 1186669477 | X:11755434-11755456 | CCTCTGCCAGCGGGGCGGCGGGC | No data | ||
| Right | 1186669479 | X:11755449-11755471 | CGGCGGGCGACGCAACTAACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1186669479 | Original CRISPR | CGGCGGGCGACGCAACTAAC TGG | Intergenic | ||