ID: 1186669996

View in Genome Browser
Species Human (GRCh38)
Location X:11758364-11758386
Sequence AGGTGCCGCCGCGGAGGGAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 113}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186669988_1186669996 8 Left 1186669988 X:11758333-11758355 CCCACCAAGGCGCGAGTGCTGTA 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1186669996 X:11758364-11758386 AGGTGCCGCCGCGGAGGGACAGG 0: 1
1: 0
2: 0
3: 10
4: 113
1186669986_1186669996 14 Left 1186669986 X:11758327-11758349 CCTGACCCCACCAAGGCGCGAGT 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1186669996 X:11758364-11758386 AGGTGCCGCCGCGGAGGGACAGG 0: 1
1: 0
2: 0
3: 10
4: 113
1186669989_1186669996 7 Left 1186669989 X:11758334-11758356 CCACCAAGGCGCGAGTGCTGTAC 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1186669996 X:11758364-11758386 AGGTGCCGCCGCGGAGGGACAGG 0: 1
1: 0
2: 0
3: 10
4: 113
1186669987_1186669996 9 Left 1186669987 X:11758332-11758354 CCCCACCAAGGCGCGAGTGCTGT 0: 1
1: 0
2: 0
3: 7
4: 177
Right 1186669996 X:11758364-11758386 AGGTGCCGCCGCGGAGGGACAGG 0: 1
1: 0
2: 0
3: 10
4: 113
1186669990_1186669996 4 Left 1186669990 X:11758337-11758359 CCAAGGCGCGAGTGCTGTACGAT 0: 1
1: 0
2: 0
3: 2
4: 123
Right 1186669996 X:11758364-11758386 AGGTGCCGCCGCGGAGGGACAGG 0: 1
1: 0
2: 0
3: 10
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186669996 Original CRISPR AGGTGCCGCCGCGGAGGGAC AGG Exonic
900284072 1:1890950-1890972 AGCAGCCGCCGCGGCGGGACTGG - Exonic
900512673 1:3068013-3068035 AGGCGCTGCGGCGGAGGGGCCGG - Intergenic
901920575 1:12533730-12533752 AGTTGCGGGCGGGGAGGGACAGG - Intergenic
901930948 1:12595831-12595853 AGGTGCAGACGAGGAGGGGCTGG + Intronic
903478803 1:23638331-23638353 AGCTGCCACTGTGGAGGGACAGG + Intronic
906265368 1:44424802-44424824 AGGTGGCCCAGCGGAGGGTCTGG + Intronic
906695048 1:47818038-47818060 GTGTGCCGCCGCGGAGAGGCAGG + Intronic
912376476 1:109213811-109213833 AGGCGGGGCCGCGGAGGGAGGGG - Intergenic
915824708 1:159063098-159063120 AGGTGCAGACGTGGTGGGACTGG + Intronic
924674008 1:246157163-246157185 AGGGGGCGCCCCGAAGGGACAGG - Intronic
924732570 1:246724946-246724968 AGGTGCCCCCGCTGCGGGGCAGG - Intronic
1070610050 10:77926734-77926756 GGCTGCCGCGGCGGCGGGACTGG + Intergenic
1078105345 11:8354846-8354868 AGCTTCAGCCGCGGAGGGGCCGG - Intergenic
1078495336 11:11811497-11811519 AGGTGCCGCAGCGGAAGGCCTGG - Intergenic
1083265763 11:61546209-61546231 AGTGGCCGCCGCGGCGGGGCTGG - Exonic
1083323642 11:61862581-61862603 AGGTGCTGAGGAGGAGGGACAGG + Intronic
1089495642 11:118907580-118907602 AGGTGGCGCCGCGGAGTAAGCGG - Exonic
1091000924 11:131910524-131910546 CGGTGCCGCCTCGGAGCGAGCGG - Intronic
1091108488 11:132943978-132944000 CGGTGCCGCCTCGGAGCGAGCGG + Intronic
1091226051 11:133956941-133956963 AGGTGCCGCTGCGCCGGGGCCGG - Exonic
1092038711 12:5364160-5364182 AGGTGCCGTTGCAGAGGGATGGG - Intergenic
1095643343 12:44510860-44510882 AGGTGCCGGCTCAGAGGCACAGG + Intronic
1095961125 12:47834925-47834947 AGGAGCCCCCGGAGAGGGACAGG - Intergenic
1103893084 12:124254427-124254449 AGGTGCAGCCACTGAGGGGCTGG - Intronic
1104416331 12:128599099-128599121 AGCTGCAGCCGCAGAGGAACGGG - Intronic
1106539086 13:30674197-30674219 AGCGGCCGCCGCGGGGGGAGAGG + Intergenic
1113784033 13:112993114-112993136 ACGCGCTGCCGCGGAGGGAGAGG + Intronic
1118601307 14:67472925-67472947 AGCTGCAGCCGAGGAGAGACTGG - Exonic
1121467394 14:94124811-94124833 AGGTGCCTCCAGGGAGAGACAGG - Intergenic
1122204912 14:100143495-100143517 AGGGGCCGCCGCAGAAGGAATGG + Intronic
1122666619 14:103334447-103334469 AGGTGCCGCCGCCGAGCAGCGGG - Exonic
1124190710 15:27574257-27574279 AGGTGGCGCTGCGGCGGGTCGGG + Intergenic
1129644697 15:77419725-77419747 CGGGGCCGCCGCCGAGGGAGGGG + Intronic
1130979447 15:88803023-88803045 TGAGGCCGCCGCGGCGGGACAGG - Intergenic
1131053952 15:89364798-89364820 AGGTGCCTCCACGGAGGGCCTGG - Intergenic
1132775755 16:1592929-1592951 AGGTGCCCCGGCAGAGTGACTGG + Intronic
1132897685 16:2236721-2236743 AGGGGCGGCCGCGGAGGGAAGGG + Exonic
1132954751 16:2585659-2585681 AGGGGCCGGCGTGGAGGGGCCGG + Intronic
1133188394 16:4116167-4116189 AGCTGCGGCCGCGGCGGGAGCGG - Exonic
1137013856 16:35352681-35352703 AGCGGCTGCCGGGGAGGGACTGG + Intergenic
1138448855 16:57081145-57081167 AGGTGCTGCCGCAGATGGGCCGG + Exonic
1141252133 16:82368624-82368646 AGGTGCCTCATCGGAAGGACTGG - Intergenic
1141685352 16:85566885-85566907 AGGGGCCGCAGCGGAAGGGCCGG + Intergenic
1141958828 16:87391614-87391636 AGGCGCCGCGGCAGGGGGACTGG + Intronic
1145814171 17:27783578-27783600 CGGAGCTGCCACGGAGGGACTGG - Intronic
1147139532 17:38453626-38453648 AGGGGCCGCCCCGGAGGGGGAGG + Intronic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1150562069 17:66302795-66302817 AGCTGCGGCCGCGGAGGGCCGGG - Intronic
1151663754 17:75533921-75533943 AGGTGCCTCATGGGAGGGACTGG - Intronic
1152518128 17:80838018-80838040 GGCTGCCGCCGCGGATGCACAGG - Intronic
1154386021 18:13892422-13892444 GGGTGCCGGTGGGGAGGGACGGG - Intronic
1157384178 18:47247881-47247903 GGGTGCCGCCGCTGAGGCCCTGG - Intronic
1160070832 18:75626409-75626431 AGGTGCTGCCACGGTGGGTCAGG - Intergenic
1160488144 18:79312124-79312146 AGGTGCCTTCGCGGAGGTGCTGG + Intronic
1160956988 19:1698407-1698429 AGGTGCCTCTGCAGTGGGACGGG + Intergenic
1161060827 19:2213989-2214011 GGGTGCCGCGGCGCAAGGACAGG + Intronic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1163315246 19:16536702-16536724 AGATGCTGCTGGGGAGGGACGGG - Intronic
1165871479 19:38975991-38976013 AGACGCCCCCGCGGGGGGACTGG + Intergenic
1166984142 19:46649575-46649597 AGGCGCCGCCGCCGGGGGGCGGG - Exonic
1167960954 19:53103622-53103644 AGGAGCCGCCGGGGAAGGGCGGG + Intergenic
926089993 2:10043517-10043539 CGGGGCGGCCGCGGAGGGAGCGG - Intronic
926359049 2:12067909-12067931 AGGTGCTGCCGGTGAGGGACTGG - Intergenic
926684082 2:15685132-15685154 AGGTGCCGCGGGGCAGGGAGAGG - Intergenic
928174646 2:29025493-29025515 AGGTGCTGGCATGGAGGGACAGG + Intronic
934718154 2:96555006-96555028 AGGTTCCACCGAGGAGGCACTGG + Intergenic
941462995 2:165793748-165793770 AGGGGCCGCCCCATAGGGACTGG + Intronic
949041702 2:241852600-241852622 AGGTGCGGCCTCGGAGGCCCCGG - Exonic
1169367261 20:5001504-5001526 AAATGGCGCCGCGGAGGGGCGGG + Intronic
1175265858 20:57703224-57703246 AGGTGCAGCGGGGGAGGGCCGGG - Intronic
1175517240 20:59577447-59577469 AGGCGCCGGCGGGGCGGGACCGG - Intergenic
1180614993 22:17121019-17121041 AGGAGCCCCCGCGGAGGAAGAGG + Exonic
1183269184 22:36850100-36850122 AGGGGCCGCTGTGGAGGGAAAGG + Intergenic
1183517026 22:38272715-38272737 CGGTGCGGCCGCGGAGGGAGGGG - Intronic
1184095522 22:42314330-42314352 AGCTGCCGCTGCCGGGGGACAGG + Intronic
1185261249 22:49865151-49865173 AGTTGCAGCCTCGGAGTGACAGG - Intronic
953031229 3:39181068-39181090 GCGTGCCGCCGAGGAGGGGCGGG - Intergenic
954708181 3:52492157-52492179 AAGAGCCGCCGCAGAGAGACAGG + Exonic
959540013 3:107525871-107525893 AGGTGCCACCGCGGCGGCAGCGG - Intronic
959603983 3:108222246-108222268 AGGTCCCGTGGCGAAGGGACCGG - Exonic
967904085 3:194486738-194486760 AGGAGGCGCCGCGGCGGGGCCGG + Intronic
967904143 3:194486922-194486944 GGGCGCCGCCGCGGAGGGGAGGG - Intronic
968470882 4:781786-781808 AGGTGCGGCCGCGGGGTGAGCGG + Intergenic
968923026 4:3532392-3532414 AGATGGCGCCGCGGAGGGTCAGG - Exonic
969299728 4:6290891-6290913 AGGTGCAGACCCGGAGGCACAGG - Intronic
969311873 4:6357653-6357675 AAGTGCAGCCCTGGAGGGACAGG + Intronic
972853011 4:43073198-43073220 AGGTGCAGACGTTGAGGGACAGG + Intergenic
973551293 4:52038301-52038323 GGGTGCGGTCGCGGAGGGGCGGG - Exonic
975612144 4:76213735-76213757 GGATGGGGCCGCGGAGGGACGGG + Exonic
985727431 5:1523624-1523646 AGGCGCGGCCGAGGAGGGGCCGG - Intronic
985844541 5:2334638-2334660 AGGAGCCGAGGCGCAGGGACTGG - Intergenic
987050760 5:14144767-14144789 AGGCGCCGCCGCTGGGGTACCGG - Intronic
990347446 5:54884123-54884145 CGGGGCCGCCGCGGCGGGATGGG - Intergenic
996784984 5:127228898-127228920 AGGTGCGGCCGGCGGGGGACAGG - Intergenic
1002291747 5:178205049-178205071 AGGTGCGGCCGCGGGCGGACGGG + Intronic
1003175445 6:3750422-3750444 AGGGGCCGCCTGGGAGGGCCGGG - Intronic
1006375807 6:33671110-33671132 AGGGGCCGGCGCGTAGGGGCGGG - Intronic
1011490774 6:87889368-87889390 AGGTGCCACAGCTGAGGGAGTGG + Intergenic
1011643008 6:89433023-89433045 AGGTGGCACCGCGGAGGCCCTGG - Intergenic
1019453218 7:1110396-1110418 AGGTGCCGGCGCGGGGAGAGGGG - Intronic
1020004560 7:4775491-4775513 AGGTGCCGCGGCCGGGGGTCCGG - Intronic
1020037535 7:4973936-4973958 GGGTGCTGCGGAGGAGGGACCGG - Intergenic
1020162278 7:5781651-5781673 AGGTGACGCCGCGGCAGGGCCGG - Exonic
1026833356 7:73623246-73623268 AGGAGGCGCCGCGGAGGAAGAGG + Intronic
1029574938 7:101397113-101397135 TGGTTCTGCCGGGGAGGGACAGG - Intronic
1035071247 7:156146542-156146564 AGGTGCTGACCGGGAGGGACTGG - Intergenic
1039903109 8:41767100-41767122 GGCTGCGGCCGCGGAGGGGCTGG - Intronic
1043296174 8:78666139-78666161 AGGTGGCGCGATGGAGGGACTGG + Exonic
1044306466 8:90645935-90645957 GGGCGCCGCGGCGGAGGGGCTGG - Exonic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1049676725 8:143892547-143892569 AGGTGCCGGCGAGGGGGGCCGGG + Intergenic
1050537724 9:6645209-6645231 AGGGGAGGCCGCGGAGGGCCGGG + Intronic
1055090984 9:72364790-72364812 TGGTGCCGCCGCCGCGGGCCGGG + Intronic
1057646182 9:96877329-96877351 AGATGCCGCTGCGCAGGGACAGG + Intergenic
1057869895 9:98709310-98709332 AGCTGGCGCAGCGGAGGGCCGGG - Intergenic
1059145607 9:111896881-111896903 AGGTGCCCGCGCGCAGGGTCTGG + Exonic
1060757361 9:126223294-126223316 AGGCGCCGCAGCGCAGGGCCTGG + Intergenic
1061483364 9:130908239-130908261 TGGTGCGGCAGAGGAGGGACTGG + Intronic
1061623003 9:131823940-131823962 TGGGGCCGCCGCGGAGAGCCCGG + Intergenic
1062715935 9:138010080-138010102 AGGTGGCGACAGGGAGGGACCGG + Intronic
1062718695 9:138023661-138023683 AGGAGCCGGCGCGGCGGCACCGG + Exonic
1186425980 X:9464874-9464896 AGGAGCCGCGGGGGAGGGGCAGG + Intronic
1186669996 X:11758364-11758386 AGGTGCCGCCGCGGAGGGACAGG + Exonic
1189066394 X:37813944-37813966 AGGTGCTGCCATGGAGGGAAAGG + Intronic