ID: 1186670809

View in Genome Browser
Species Human (GRCh38)
Location X:11765452-11765474
Sequence CTCCATCTTCCCTAGGAGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 829
Summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 781}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186670803_1186670809 16 Left 1186670803 X:11765413-11765435 CCATGTTCTGGAAAGGCCCTTTG 0: 1
1: 0
2: 2
3: 18
4: 173
Right 1186670809 X:11765452-11765474 CTCCATCTTCCCTAGGAGCCAGG 0: 1
1: 0
2: 1
3: 46
4: 781
1186670804_1186670809 0 Left 1186670804 X:11765429-11765451 CCCTTTGAGCCATGTGTGACATC 0: 1
1: 0
2: 2
3: 15
4: 181
Right 1186670809 X:11765452-11765474 CTCCATCTTCCCTAGGAGCCAGG 0: 1
1: 0
2: 1
3: 46
4: 781
1186670806_1186670809 -9 Left 1186670806 X:11765438-11765460 CCATGTGTGACATCCTCCATCTT 0: 1
1: 0
2: 1
3: 23
4: 184
Right 1186670809 X:11765452-11765474 CTCCATCTTCCCTAGGAGCCAGG 0: 1
1: 0
2: 1
3: 46
4: 781
1186670805_1186670809 -1 Left 1186670805 X:11765430-11765452 CCTTTGAGCCATGTGTGACATCC 0: 1
1: 0
2: 0
3: 11
4: 117
Right 1186670809 X:11765452-11765474 CTCCATCTTCCCTAGGAGCCAGG 0: 1
1: 0
2: 1
3: 46
4: 781

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186670809 Original CRISPR CTCCATCTTCCCTAGGAGCC AGG Exonic
900186607 1:1335993-1336015 CACCATCTGCCCTGGCAGCCTGG - Exonic
900935348 1:5762662-5762684 CCTCATCTTCCCTAGTAGCTGGG - Intergenic
901236785 1:7671505-7671527 CTCCATCCTCCCGAGGGCCCTGG + Intronic
901403369 1:9029934-9029956 CTTCAGCTTCCCTAGTAGCTGGG - Intergenic
901495833 1:9621245-9621267 CTCCATCTTGAATAGGAGCTGGG - Intergenic
901620305 1:10579943-10579965 CTCCATCTTGAGTAGGAGCTGGG - Intronic
901643544 1:10704985-10705007 CTCCATCCTCCCTAAGAGGCTGG - Intronic
901698891 1:11032493-11032515 CTTCAGCTTCCCCAGTAGCCGGG - Intronic
902675791 1:18007771-18007793 TTCCATCCTCCCTACGAGCCTGG - Intergenic
902947429 1:19851864-19851886 CTCCATCTTAAATAGGAGCTGGG - Intergenic
902998642 1:20248270-20248292 CTCCATCTTAAATAGGAGCTGGG + Intergenic
903236729 1:21955530-21955552 CTCCATCTTCCCAGAAAGCCAGG + Intergenic
903954450 1:27015419-27015441 CTCCATCTTGTCTAGGATCAGGG + Intergenic
904099749 1:28014610-28014632 CCTCATCTTCCCTAGTAGCTGGG - Intronic
904566962 1:31434033-31434055 CACCATCTTCCCCATGAGCCTGG - Intronic
904587812 1:31589507-31589529 CTCCATCTTGAATAGGGGCCGGG + Intergenic
904587981 1:31590656-31590678 CTCCATCTTGAATAGGAGCTGGG - Intergenic
905036008 1:34918737-34918759 CCCCATATACCCTAGGACCCTGG + Intronic
905351266 1:37348103-37348125 CTTCATCTTCCCCAGGAGGCTGG + Intergenic
905428912 1:37907506-37907528 CTCCATCTTGAATAGGGGCCAGG + Intronic
907554669 1:55333866-55333888 TTCCATCTGCCCTTGGAGGCAGG + Intergenic
908217355 1:61967086-61967108 CTCCATCTTAAATAGGAGCTGGG - Intronic
908851858 1:68385014-68385036 CTCCATCTTGCATAGGCGCTGGG + Intergenic
909800086 1:79796385-79796407 CTCCATCTTGGATAGGAGCTGGG - Intergenic
910104333 1:83615139-83615161 CTTAATCTTGTCTAGGAGCCAGG + Intergenic
910614115 1:89178208-89178230 CTTCAGCTTCCCTAGTAGCTGGG - Intergenic
911837965 1:102645465-102645487 CTTCATCTTCTCTAGGAGTTTGG - Intergenic
911837978 1:102645532-102645554 CTTCATCTTCTCTAGGAGTTTGG - Intergenic
911847700 1:102775238-102775260 CTCCATCTTAAATAGGAGCTGGG - Intergenic
911951288 1:104176897-104176919 CTCTATCTTGACTAGGAGCTGGG + Intergenic
911953290 1:104204447-104204469 CTCCATCTTTAATAGGAGCTAGG - Intergenic
912001312 1:104838065-104838087 CTCCATCTTGAATAGGAGCTGGG - Intergenic
912450221 1:109763792-109763814 CCCGATCTTCCCTGGGGGCCAGG + Intronic
912799944 1:112714446-112714468 CGCCAGCTTCCCCAGGAGCGGGG - Intronic
913406006 1:118491085-118491107 CTCCATCTTGAGTAGGAGCTGGG - Intergenic
914817793 1:151075808-151075830 CTCCATCTTGCATAGGAGTTGGG - Intronic
915039706 1:152958481-152958503 CTCCATCTTGAATAGGAGCTGGG + Intergenic
915463857 1:156084590-156084612 CTCCGTCTGCCCCAGGAACCTGG + Intronic
916226672 1:162496011-162496033 CTCCATCTTGAATAGGAGCTGGG - Intergenic
916796780 1:168174912-168174934 CTTCAGCTTCCCTAGTAGCTGGG - Intergenic
916810810 1:168304077-168304099 CTCCATCTTGAATAGGGGCCGGG - Intronic
916814069 1:168333707-168333729 CTCCATCTTGAATAGGAGCTGGG - Intergenic
916985122 1:170182668-170182690 CTCCATCTTGAATAGGAGCTGGG + Intergenic
917215762 1:172676510-172676532 CTCCATCTTAAATAGGAGCTGGG + Intergenic
917293241 1:173493063-173493085 CTCCATCTTAAATAGGAGCTGGG + Intergenic
918532690 1:185540480-185540502 CTCCATCTTGAATAGGAGCTCGG - Intergenic
918968684 1:191383516-191383538 CTCAATCTTCAATAGGAGCTGGG + Intergenic
919059952 1:192619743-192619765 CTCCACCCTCCCTGAGAGCCAGG - Intergenic
920015405 1:202903586-202903608 CTTCAGCTTCCCTAGTAGCTGGG + Intronic
920113016 1:203600407-203600429 CTCCATTTTGACTAGGAGCTGGG - Intergenic
920144994 1:203852336-203852358 CTTCATCTTTCCCAGGATCCAGG - Exonic
920559784 1:206930954-206930976 CTCAATCTGCCCTAGGACTCAGG - Intronic
920819338 1:209365690-209365712 TTCCATCTTCCCCTGGACCCAGG - Intergenic
920821185 1:209382929-209382951 CTCCATCTTGAATAGGAGCTGGG + Intergenic
920857212 1:209673054-209673076 CACCTTCTACCCTAGGAGCCAGG + Intergenic
920864610 1:209741474-209741496 CTCCAGGTGCCCAAGGAGCCAGG - Intergenic
921076838 1:211706751-211706773 CTCCATCTTGAATAGGAGCTGGG + Intergenic
921077345 1:211710737-211710759 CTCCATCTTAAATAGGAGCTGGG + Intergenic
921132539 1:212232192-212232214 CTCCCACTTCCTTAGCAGCCGGG + Intergenic
921256434 1:213344648-213344670 CTTCAGCTTCCCTAGTAGCTGGG + Intergenic
921361172 1:214332368-214332390 CACCATCATCCCAAGGAGACAGG + Intronic
921367014 1:214383659-214383681 CTCCATCTTCTCCCGGAGCATGG + Exonic
921570399 1:216771088-216771110 CTCCAGCCTCCCAAGTAGCCAGG + Intronic
921820314 1:219609668-219609690 CTTCATCTTTCCCAGGATCCAGG + Intergenic
922081873 1:222305290-222305312 CTTCAGCTTCCCAAGTAGCCGGG - Intergenic
922172448 1:223167133-223167155 CTCCATCTTCAATGGGAGCTGGG + Intergenic
922243043 1:223769234-223769256 CTCCAGCCTCCCTAGTAGCTAGG + Intronic
922935763 1:229421022-229421044 CTCCATCTGTCGCAGGAGCCTGG + Intergenic
923601864 1:235410651-235410673 CTCCATCTTGAATAGGAGCTGGG - Intronic
923986821 1:239391020-239391042 CTGCATCTTCCTTAGTAGCTAGG - Intronic
924577097 1:245290750-245290772 CTCCATCTTGAATAGGAGCTGGG - Intronic
924646969 1:245887035-245887057 CTCCATCTTGAATAGGGGCCTGG + Intronic
1063137177 10:3228100-3228122 CTCCAGCTTCCCAAGGTGCTAGG - Intergenic
1064098698 10:12444273-12444295 CTCCATCTTGAATAGGAGCTGGG - Intronic
1064438270 10:15330224-15330246 CTGCTTCTTCCCTAGTAGCTGGG - Intronic
1064621479 10:17222048-17222070 CTCCAACCTCCCTAGTAGCTGGG + Intergenic
1064938314 10:20704952-20704974 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1065123051 10:22546525-22546547 CTTCAGCTTCCCTAGTAGCTAGG + Intronic
1065290331 10:24223216-24223238 CTCCATCTTAAATAGGAGCTAGG - Intronic
1065487249 10:26247440-26247462 CTCCATCTTGAATAGGAGCTGGG - Intronic
1065804312 10:29380802-29380824 CTCCCTCCTCCCCAGGAGTCTGG - Intergenic
1065944873 10:30597218-30597240 CTCCCTCCTCCCCAGGAGTCTGG + Intergenic
1066248452 10:33608757-33608779 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1067328413 10:45291893-45291915 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1069024563 10:63524894-63524916 CCTCAGCTTCCCTAGTAGCCAGG - Intronic
1069270211 10:66517283-66517305 CTCCATCTTGAATAGGAGCTTGG + Intronic
1069935298 10:71911595-71911617 ATCCATCTCCCTGAGGAGCCTGG - Intergenic
1071392025 10:85184811-85184833 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1071392626 10:85190779-85190801 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1072215415 10:93283570-93283592 CTCCATCTTGAATAGGGGCCGGG - Intergenic
1072324524 10:94284630-94284652 CTCCATCTTCCCTCAGTGCATGG - Intronic
1073531467 10:104236400-104236422 CTCCATCTTAAATAGGAGCTGGG + Intronic
1073917797 10:108426828-108426850 CTCCATCTTCTATAGGCTCCAGG - Intergenic
1074338725 10:112605207-112605229 CTCTTTCTGCCCCAGGAGCCAGG - Intronic
1074877435 10:117625020-117625042 CTCCATCTTCCTTGGGAACACGG - Intergenic
1075012887 10:118889952-118889974 CTTCAGCTTCCCTAGTAGCTGGG + Intergenic
1075022557 10:118962386-118962408 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1075888925 10:125928552-125928574 CTCCATCTTGAATAGGAGCTGGG - Intronic
1075928050 10:126269349-126269371 CTCCATCTTGAATAGGAGCTGGG - Intronic
1075961730 10:126572766-126572788 CTCCATCTTGAATAGGAGCTGGG - Intronic
1075977529 10:126708574-126708596 CTCCATCTTAAATAGGAGCTAGG - Intergenic
1076336076 10:129707159-129707181 CCTCATCTTCCCTAGTAGCTGGG - Intronic
1076367953 10:129934359-129934381 CTCCATCTTCACTAGCAACTTGG + Intronic
1076449852 10:130549427-130549449 CACCATCAGTCCTAGGAGCCAGG + Intergenic
1076567096 10:131406365-131406387 CTCTATTTCCCCTAGGAGCAAGG + Intergenic
1076669913 10:132114328-132114350 CTTCATCTTCCCAAGTAGCTGGG + Intronic
1077005328 11:352544-352566 CTCCATCTTGATTAGGAGCTGGG - Intergenic
1077029215 11:456290-456312 CTCCCTCTTCCCAAGTAGCTGGG + Intronic
1077516699 11:3006621-3006643 CATCATCTCCCCTAGGGGCCTGG - Intronic
1077784502 11:5367725-5367747 CTCCATCTTAAATAGGAGCTGGG - Intronic
1077859377 11:6161261-6161283 CTCCATCTTGACTAGGAGCTGGG - Intergenic
1077873555 11:6283673-6283695 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1077874013 11:6288230-6288252 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1078050362 11:7960505-7960527 CTCCATCTGCCCCTGCAGCCAGG + Exonic
1079412249 11:20200525-20200547 CTCCATCTTAAGTAGGAGCTGGG + Intergenic
1079717967 11:23771908-23771930 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1080288599 11:30644947-30644969 CTCCATCTTGGGTAGGAGCTGGG + Intergenic
1080352780 11:31404280-31404302 CTCCATCTTGAATAGGAGCTGGG - Intronic
1081129596 11:39362131-39362153 CTTCAGCTTCCCTAGTAGCTGGG - Intergenic
1082867309 11:57911678-57911700 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1083144591 11:60749006-60749028 CTCCATCGTCACTAAGGGCCAGG - Intergenic
1083160034 11:60849057-60849079 CTCCTTCCTCCCCAGGGGCCTGG + Intronic
1084193675 11:67511018-67511040 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1084635794 11:70391684-70391706 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1084688981 11:70714016-70714038 CTCCCTCTACCCCAGGGGCCAGG + Intronic
1085096803 11:73767929-73767951 CTCAATCTTCCCAAGTAGCTGGG - Intergenic
1085395376 11:76204617-76204639 GTCCATCTCCCCCAAGAGCCTGG + Intronic
1086378362 11:86225015-86225037 CTTCAGCTTCCCTAGTAGCTGGG + Intergenic
1086572776 11:88304551-88304573 CTCCATCTTGAATAGGAGCTGGG + Intronic
1086920638 11:92582331-92582353 CTCCATCTTGAATAGGAGCTGGG - Intronic
1087272058 11:96121900-96121922 CTCCAGCCTCCCTAGCAGCTGGG + Intronic
1087470868 11:98572466-98572488 CTCCCTCTCCCCTGGAAGCCAGG - Intergenic
1087531403 11:99386701-99386723 CTCCATCTTGAATAGGAGCTGGG - Intronic
1087789949 11:102395089-102395111 CTCCAGCCTCCCTAGTAGCTGGG - Intergenic
1087843072 11:102940061-102940083 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1088102493 11:106170678-106170700 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1088253528 11:107881886-107881908 CTCCATCTTGAATAGGAGCTAGG - Intronic
1088581339 11:111319801-111319823 CTCCATCTTGAATAGGAGCTAGG + Intergenic
1091025693 11:132139005-132139027 CTCCATCTGCCATTGGAGCTTGG - Intronic
1091572155 12:1696509-1696531 CTTCAGCTTCCCAAGTAGCCGGG + Intronic
1091685970 12:2562653-2562675 CACCATCCTCCCTCGGATCCAGG + Intronic
1092165021 12:6337126-6337148 CTCTCTGATCCCTAGGAGCCAGG + Intronic
1092212058 12:6652763-6652785 CTCCCTCTTCCCTAGAAGGCCGG - Exonic
1092354921 12:7786842-7786864 CTCCATCTTCAATAGGAGCTGGG - Intergenic
1092367629 12:7890170-7890192 CTCCATCTTCAATAGGAGCTGGG - Intronic
1092460223 12:8679846-8679868 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1092782337 12:11998891-11998913 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1093425242 12:19021450-19021472 TTCCGTCTCCCCTAGGAGTCTGG + Intergenic
1093461875 12:19414301-19414323 CTCCATCTTGAATAGGAGCTGGG - Intronic
1093471441 12:19506210-19506232 CTGCAGCTTCCCTAGTAGCTGGG + Intronic
1093735235 12:22613606-22613628 CTCCATCTTGAATAGGAGCTAGG + Intergenic
1094100456 12:26756816-26756838 CTCCATCTTGAATAGGAGCTGGG + Intronic
1094221742 12:28001282-28001304 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1095773908 12:45991444-45991466 CCTCATCTTCCCGAGGAGCTGGG - Intronic
1095820764 12:46476359-46476381 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1095930442 12:47620142-47620164 ATCCCTGTACCCTAGGAGCCAGG + Intergenic
1095978845 12:47958737-47958759 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1096808491 12:54155172-54155194 GTCCTTCTTCCCTAGGAGAAAGG + Intergenic
1097116245 12:56699509-56699531 CTCCATCTTGAATAGGAGCAGGG - Intergenic
1097456492 12:59804629-59804651 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1097591806 12:61583508-61583530 CTCCACCTTACGTAGGAGCTGGG - Intergenic
1098228846 12:68352226-68352248 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1098926122 12:76350787-76350809 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1099020182 12:77393564-77393586 CTCCAGCTTCCCGAGTAGCTGGG + Intergenic
1099172067 12:79376639-79376661 CTCCATCTTAAATAGGAGCTGGG - Intronic
1100502707 12:95189530-95189552 CTTCATCTTCCCAAGTAGCTGGG - Intronic
1101113927 12:101513441-101513463 CTTCAACTTCCCAAGTAGCCGGG - Intergenic
1101419086 12:104534383-104534405 CTCCTTCTTCCCTCAGAACCGGG + Intronic
1101986497 12:109451487-109451509 CTTCTGCTTCCCTTGGAGCCTGG - Exonic
1102028448 12:109726731-109726753 TTCCCGCTTCCCTAGGGGCCTGG + Intronic
1102074674 12:110050370-110050392 CTCCATCTTAAATAGGAGCTGGG + Intronic
1102100112 12:110271816-110271838 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1102362476 12:112300191-112300213 CTTCAGCTTCCCTAGTAGCTGGG - Intronic
1102371962 12:112389316-112389338 CTTCAGCCTCCCTAGTAGCCGGG + Intergenic
1102536356 12:113584279-113584301 CTCCATCTTGACCAGGAGCTGGG - Intergenic
1102774406 12:115506200-115506222 CTCCATCTTCAATAGGGGCTGGG + Intergenic
1102856163 12:116295922-116295944 CTCCAGCTTCCCTAACAGACTGG - Intergenic
1102871518 12:116417777-116417799 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1102878807 12:116468374-116468396 CTCCAGCCTCCCTAGTAGCTGGG + Intergenic
1102890696 12:116556532-116556554 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1103134014 12:118492034-118492056 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1103389327 12:120559809-120559831 CTCCAGCCTCCCTAGTAGCTGGG + Intronic
1103548140 12:121716190-121716212 CTCCAGCCTCCCTAGTAGCTGGG - Intronic
1103548172 12:121716445-121716467 CTACATCTTCCTTAGAATCCGGG + Intronic
1103657053 12:122479924-122479946 CCCCAGCCTCCCTAGTAGCCAGG + Intronic
1103924224 12:124414769-124414791 CTCCATCTTCCCGTGGTGCCTGG + Intronic
1104361720 12:128139306-128139328 CTCCATCTTGAGTAGGAGCTGGG - Intergenic
1104714077 12:131005198-131005220 CTGCCTCTGCCCTAGGAGCAGGG - Intronic
1105207980 13:18238998-18239020 CTCCATCTTCCCCAAAAGACAGG + Intergenic
1105397084 13:20046436-20046458 CTTCAGCCTCCCAAGGAGCCAGG - Intronic
1105502269 13:20982873-20982895 CTCCAGCCTCCCGAGTAGCCGGG - Intronic
1106331825 13:28746413-28746435 CTCCATCTTGAATAGGAGCCGGG - Intergenic
1106405148 13:29466759-29466781 CTCCAGCTGCCCTAGTAGCTGGG - Intronic
1106711727 13:32342931-32342953 CTTCAACTTCCCTAGTAGCTGGG - Intronic
1106800865 13:33254786-33254808 CACGATCTTCCCTTGAAGCCTGG - Intronic
1107104268 13:36626555-36626577 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1107699729 13:43035834-43035856 CTTCAGCTTCCCAAGGAGCTGGG + Intronic
1107985314 13:45770909-45770931 TTCCCTCTTCCCTAGGAAGCGGG - Intergenic
1108509181 13:51139460-51139482 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1109610479 13:64758359-64758381 CTCCATCTTGAATAGGAGCTTGG - Intergenic
1109704699 13:66074396-66074418 CTCCATCTTGACTAGGAGCTAGG - Intergenic
1109990334 13:70046601-70046623 CTTCAGCTTCCCTAGTAGCTGGG + Intronic
1110406856 13:75160548-75160570 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1110684614 13:78357599-78357621 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1111563013 13:89977384-89977406 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1112903828 13:104392396-104392418 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1113236207 13:108277977-108277999 CTCCATCTTGGATAGGAGCTGGG - Intronic
1113845832 13:113390790-113390812 CTCCATCTTGAGTAGGAGCTGGG + Intergenic
1114268791 14:21089002-21089024 CTGGATCTTCTCTAGAAGCCAGG - Exonic
1114384927 14:22244460-22244482 CTCCATCTTCCCCAGTAGGCAGG + Intergenic
1114505536 14:23209394-23209416 CTCCATCTTAAATAGGAGCTGGG - Intronic
1114584266 14:23795449-23795471 CTCCATCTTGAATAGGAGCCGGG - Intergenic
1114616011 14:24068843-24068865 CGCCAGCCTCCCCAGGAGCCAGG + Exonic
1114764532 14:25355998-25356020 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1115449241 14:33527180-33527202 CTCCGTCTTCCCTAGTAGCTGGG + Intronic
1116556735 14:46320880-46320902 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1116916581 14:50532044-50532066 CTCCATCTTCACTTAGGGCCCGG + Exonic
1116957318 14:50938002-50938024 CTCCATCTTGAATAGGAGCTGGG + Intronic
1117110990 14:52454308-52454330 CTTCAGCTTCCCAAGTAGCCAGG - Intronic
1117956088 14:61124712-61124734 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1118315588 14:64723995-64724017 CTCCTACTTCCCTAGCAGACAGG + Intronic
1118399366 14:65365423-65365445 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1118781541 14:69011877-69011899 GCCCATCTTCCCCAGAAGCCAGG + Intergenic
1118800703 14:69186824-69186846 CTCCAGCTTCCCAAGTAGCTTGG + Intergenic
1118947716 14:70403365-70403387 CTCCATCTTGAATAGGAGCTAGG + Intronic
1118997884 14:70853800-70853822 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1119354377 14:73993219-73993241 CTCCAGCTTCCCAAGTAGCTAGG - Intronic
1119691902 14:76679715-76679737 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1119735934 14:76982094-76982116 GTGCATCTTCCCCAGGAGCAGGG + Intergenic
1120044356 14:79789881-79789903 CTCCATCTTGAATAGGAGCTGGG - Intronic
1120419206 14:84261190-84261212 CCTCAGCTTCCCTAGGAGCTGGG - Intergenic
1120436935 14:84494154-84494176 CTCCATCTTGAGTAGGAGCTGGG - Intergenic
1121071493 14:91026344-91026366 CCTCAGCTTCCCTAGGAGCTGGG + Intronic
1121194053 14:92054238-92054260 CTCCATCTTGAATAGGAGCTGGG + Exonic
1121379382 14:93449500-93449522 CTTCATCTTCCCAAGTAGCTGGG - Intronic
1121794056 14:96721153-96721175 CTCCATCTTGAATAGGAGCTTGG - Intergenic
1122260450 14:100517044-100517066 CTTCAGCTTCCCAAGTAGCCAGG + Intronic
1122632919 14:103115715-103115737 CTCCAGCCTCCCTAGCAGCTGGG + Intergenic
1122910862 14:104826977-104826999 TTCCAGCTTCCCTGGGAGCCCGG - Intergenic
1124720795 15:32109484-32109506 CTCCATCTTAAATAGGAGCTGGG - Intronic
1124795964 15:32780167-32780189 CTCCATCTTCAATAGAAGCTGGG + Intronic
1125817605 15:42600154-42600176 CTTCATCTCCTCTAGGAGTCTGG - Intronic
1126118905 15:45233636-45233658 TTCCATCTGGCCTTGGAGCCAGG - Intergenic
1127162423 15:56203490-56203512 CTCCATCTTAAATAGGAGCTGGG + Intronic
1127344567 15:58081194-58081216 CTCCATCTTGAATAGGAGCTGGG - Intronic
1127470377 15:59284563-59284585 CCTCAGCTTCCCTAGTAGCCAGG + Intronic
1127744502 15:61952826-61952848 CTCCTGCTTCCCAAGTAGCCAGG + Intronic
1127966741 15:63928354-63928376 CTCAATGATCCCTATGAGCCAGG - Intronic
1128232521 15:66045545-66045567 CTCCATTTCCCCTTGTAGCCAGG + Intronic
1129335329 15:74848774-74848796 ATCCCTCCTCACTAGGAGCCAGG + Intronic
1131002657 15:88951004-88951026 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1131287622 15:91074887-91074909 CTTCATCTCCCCTAGGAGATGGG - Intergenic
1131365980 15:91840076-91840098 CTCCATCTTGAATAGGAGCTTGG - Intergenic
1132373472 15:101313282-101313304 CAGCATCTTCCCCAGGGGCCGGG - Intronic
1133268217 16:4597382-4597404 CTCCATCTGCCCTGGCCGCCCGG - Intronic
1133561854 16:6957724-6957746 CTCCATCTTCAATAGGGGCTGGG - Intronic
1133569260 16:7025495-7025517 CTCCATCTTCCATAGGGGCTGGG - Intronic
1133763560 16:8819577-8819599 CTTCAGCCTCCCTAGTAGCCAGG - Intronic
1134583169 16:15388878-15388900 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1134765862 16:16757355-16757377 CCCCATCTTCACCATGAGCCTGG - Intergenic
1134804439 16:17112714-17112736 CTCCTTCTTCCCCATGAACCAGG - Intronic
1134980188 16:18601859-18601881 CCCCATCTTCACCATGAGCCTGG + Intergenic
1135141078 16:19922514-19922536 CTCCAGCTTCCATGGGAGACAGG + Intergenic
1135169751 16:20173384-20173406 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1135314670 16:21434422-21434444 CTCCATCTTAAATAGGAGCCGGG + Intronic
1135367593 16:21866702-21866724 CTCCATCTTAAATAGGAGCCGGG + Intronic
1135391078 16:22093878-22093900 CCCCATCCTCCCTAGTAGCTGGG + Intronic
1135425116 16:22328604-22328626 TGCCATCTTCCCGAAGAGCCAGG + Intronic
1135444221 16:22504460-22504482 CTCCATCTTAAATAGGAGCCGGG - Intronic
1135801479 16:25501056-25501078 ATTCATCTTCCTTAGTAGCCAGG - Intergenic
1135810154 16:25579497-25579519 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1135811109 16:25587580-25587602 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1135959685 16:26985287-26985309 CTCCATCTGCTATAGGAGCTGGG + Intergenic
1136193115 16:28630499-28630521 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1136311334 16:29413104-29413126 CTCCATCTTAAATAGGAGCCGGG + Intergenic
1136324782 16:29514897-29514919 CTCCATCTTAAATAGGAGCCAGG + Intergenic
1136439467 16:30254882-30254904 CTCCATCTTAAATAGGAGCCAGG + Intergenic
1136598355 16:31266981-31267003 CCCCATCTTCCCAAGTAGCTGGG + Intronic
1137513712 16:49124262-49124284 CTCCTTCTTCCCATGGAGGCTGG - Intergenic
1137555678 16:49468943-49468965 CTTCATGCTCCCTAAGAGCCTGG + Intergenic
1138815931 16:60202725-60202747 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1139057075 16:63198954-63198976 CTCCATCCTCCCAAGTAGCTGGG + Intergenic
1139266345 16:65642737-65642759 CTCCATCCTCCCAAGGAGCAGGG + Intergenic
1139339944 16:66261990-66262012 CTCCATCTGGGCTGGGAGCCTGG + Intergenic
1139677137 16:68531485-68531507 CTCCATCTTAAATAGGAGCTAGG - Intronic
1139858853 16:70004030-70004052 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1139885972 16:70207182-70207204 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1140017292 16:71199865-71199887 CTCCATCTTGAGTAGGAGCTGGG + Intronic
1140641380 16:76977478-76977500 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1140772191 16:78215322-78215344 CTCCATAATCCCTACGTGCCAGG + Intronic
1141387258 16:83633234-83633256 CTCCATCTTGAATAGGAGCTGGG - Intronic
1141403166 16:83768971-83768993 CTCCATCTTGAATAGGAGCTGGG - Intronic
1141760525 16:86025948-86025970 CTCCATGTTCCCCAGGAGACAGG - Intergenic
1141772872 16:86101620-86101642 ATCCATTTCCCCCAGGAGCCAGG + Intergenic
1141772888 16:86101671-86101693 ATCCATTTCCCCCAGGAGCCAGG + Intergenic
1141772919 16:86101773-86101795 ATCCATTTCCCCCAGGAGCCAGG + Intergenic
1142212127 16:88813267-88813289 TTCCACCTTCCCTAGGGGTCTGG - Intergenic
1142366011 16:89650064-89650086 CTCCATTCTCCCTGGGAGCCTGG + Intronic
1143144994 17:4769262-4769284 CTTCAGCTTCCTTAGTAGCCAGG - Intergenic
1143592198 17:7892106-7892128 CTGAATGCTCCCTAGGAGCCAGG - Intronic
1143961906 17:10728422-10728444 CTTCAGCTTCCCTAGTAGCTGGG + Intronic
1144014089 17:11177272-11177294 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1144473061 17:15561754-15561776 CTCCATCTTCAATAGGAGCTGGG + Intronic
1144706425 17:17371322-17371344 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1144923421 17:18782966-18782988 CTCCATCTTCAATAGGAGCTGGG - Intronic
1145027686 17:19481047-19481069 CTCCAGCCTCCCAAGTAGCCGGG - Intergenic
1145114222 17:20193368-20193390 CTCCATCTTGAATAGGAGCTGGG - Intronic
1146239099 17:31198728-31198750 CTTCAGCTTCCCTAGTAGCTGGG + Intronic
1147052359 17:37804906-37804928 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1147409675 17:40240410-40240432 CCCCATCTTCCCGAGGTACCAGG + Intronic
1147938361 17:44026840-44026862 CCCCAGCTTCCCGAGTAGCCAGG - Intergenic
1148049765 17:44764081-44764103 CTCCTTGTTCCCAAGGAGTCTGG - Intronic
1148210682 17:45806732-45806754 TCGCCTCTTCCCTAGGAGCCTGG + Intronic
1148385889 17:47234730-47234752 CTTCAGCTTCCCAAGGAGCTGGG + Intergenic
1148511358 17:48172797-48172819 CTCCTTCTTACCTATGAGCTTGG - Intronic
1148513417 17:48193155-48193177 CTCCAGCTTCCCAAGTAGCTGGG + Intronic
1148700098 17:49581968-49581990 TTCCACCTTCCCCAGTAGCCTGG + Intronic
1148814791 17:50319803-50319825 CTCCATCTTGAATAGGGGCCGGG - Intergenic
1149044055 17:52223977-52223999 CTCCATCTTGAATAGGAGCTCGG - Intergenic
1149104361 17:52944047-52944069 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1149731495 17:58951213-58951235 CTGCAGCCTCCCAAGGAGCCAGG - Intronic
1149844943 17:60002946-60002968 CTTCAGCTTCCCTAGCAGCTGGG - Intergenic
1149886534 17:60345678-60345700 CTCAATTTTTCTTAGGAGCCAGG - Intronic
1150377694 17:64695438-64695460 CCCCAGCTTCCCTAGTAGCTGGG - Intergenic
1150844222 17:68638751-68638773 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1151194753 17:72423604-72423626 GTCCATGTTGCCCAGGAGCCTGG + Intergenic
1151224635 17:72639574-72639596 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1151349981 17:73525967-73525989 ATCCATCTCCCCTGTGAGCCTGG - Intronic
1151417831 17:73978069-73978091 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1151831622 17:76555706-76555728 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1152108441 17:78343722-78343744 CTCCATCTGGCCTATGAGCGTGG + Intergenic
1152826627 17:82470185-82470207 CTCCCTGTGCCCTAGGCGCCTGG + Intronic
1152997161 18:418463-418485 CTCCATCTTAAATAGGAGCTGGG + Intronic
1152997660 18:423151-423173 CCTCATCTTCCCAAGGAGCTAGG - Intronic
1153048055 18:874439-874461 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1153148382 18:2059076-2059098 CTCCATCTTGACTAGGGGCTGGG - Intergenic
1153587775 18:6641080-6641102 CTCCACTTTCCCCAGGAGCTCGG - Intergenic
1153912826 18:9719152-9719174 CTCCAGCCTCCCTAGTAGCTGGG - Intronic
1154155575 18:11941693-11941715 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1155850613 18:30769517-30769539 CTCCATCTTCAATAGAAGCTGGG + Intergenic
1155893994 18:31300693-31300715 CTGCATCTTACCAAGGATCCTGG + Intergenic
1156291199 18:35749879-35749901 CTCCATCTTGAATAGGGGCCAGG - Intergenic
1156292322 18:35758627-35758649 CTACAGCTTCCCAAGGAGCTGGG - Intergenic
1156620296 18:38843750-38843772 TTCCCTCTTCTCCAGGAGCCTGG + Intergenic
1156815954 18:41311361-41311383 CTCCATCTTAAATAGGAGCTTGG - Intergenic
1157649439 18:49313033-49313055 CTCCATCTTGAATAGGAGCTAGG + Intronic
1157654719 18:49373668-49373690 CTCCATCTTGAATAGGAGCTGGG - Intronic
1157709850 18:49842829-49842851 CTCCACCTTTCCAAGGGGCCGGG - Intronic
1157830294 18:50851301-50851323 CTCCACCTTCCCGAGTAGCTGGG + Intergenic
1158122962 18:54070469-54070491 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1158291322 18:55948127-55948149 CTCCATCTTGAATAGGAGCTAGG + Intergenic
1158560379 18:58508339-58508361 CTCCATCTTGAATAGGAGCTGGG + Intronic
1158732515 18:60040209-60040231 CTTCAGCTTCCCTAGTAGCTGGG + Intergenic
1158885683 18:61824901-61824923 CTCCCTCTTTCCAGGGAGCCTGG - Intronic
1159517041 18:69471131-69471153 CTCCAGCTTCCCGAGTAGCTGGG - Intronic
1159675951 18:71284566-71284588 CTCCATCTTGACTAGGAGCTGGG + Intergenic
1159695998 18:71557009-71557031 CTTCAGCCTCCCCAGGAGCCTGG + Intergenic
1159916133 18:74189408-74189430 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1160073057 18:75645301-75645323 CTCTATCTTCTCTTGCAGCCTGG - Intergenic
1160153519 18:76413352-76413374 CTCCCTGCTGCCTAGGAGCCTGG - Intronic
1160185295 18:76671929-76671951 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1160977223 19:1799025-1799047 CTTCAGCTTCCCAAGTAGCCGGG - Intronic
1161243875 19:3238244-3238266 CTCCATCTTGAATAGGAGCTTGG - Intronic
1161713173 19:5861417-5861439 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1161814666 19:6492608-6492630 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1162301866 19:9849078-9849100 CTGCATCTGACCTGGGAGCCAGG - Exonic
1162549628 19:11351319-11351341 CTTCAGCTTCCCTAGTAGCTGGG - Intronic
1163542982 19:17922680-17922702 TTTCAGCTTCCCTAGTAGCCGGG - Intergenic
1163624739 19:18382693-18382715 CTTCATCCTCCCTAGTAGCTGGG - Intronic
1163632877 19:18426099-18426121 CCCCATGTTCTCTAGGGGCCGGG + Intronic
1164149802 19:22541318-22541340 CTCAATCTTCCCCGGCAGCCTGG + Intergenic
1164469977 19:28522120-28522142 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1164470674 19:28528677-28528699 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1164713906 19:30377873-30377895 CTCCATCTTGAATAGGAGCTGGG - Intronic
1164772885 19:30825558-30825580 CTTCAGCCTCCCGAGGAGCCAGG - Intergenic
1164917782 19:32065850-32065872 CTCCCCCTGCCCCAGGAGCCTGG - Intergenic
1164942287 19:32260298-32260320 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1165122187 19:33567282-33567304 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1165181683 19:33977077-33977099 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1165958776 19:39517846-39517868 CTTCAGCTTCCCAAGTAGCCGGG - Intronic
1166197748 19:41218189-41218211 CTCCAGCCTCCCTAGTAGCTGGG + Intergenic
1166321245 19:42020484-42020506 CTCCATCTTGAATAGGAGCTGGG + Intronic
1167277135 19:48545415-48545437 CTCCATCAAACCCAGGAGCCTGG + Intergenic
1167299956 19:48672538-48672560 CTCCGCCCTCCCAAGGAGCCTGG + Intronic
1167432574 19:49462815-49462837 CTCCCTCCTCCCTTGGACCCAGG - Intronic
1167495968 19:49818818-49818840 CTCCCTCCTCCCTCGGACCCAGG - Intronic
1167757553 19:51421910-51421932 CTCCATCCTCTCCAGGACCCTGG - Intergenic
1168260588 19:55191816-55191838 TTTCCTCTTCCCCAGGAGCCTGG + Intronic
925331291 2:3060708-3060730 CTCCTTCTCCCATAGGGGCCTGG - Intergenic
925688985 2:6501450-6501472 CTCCATATTCACTAGGTCCCTGG + Intergenic
925892497 2:8446969-8446991 CTCCATCTTGAATAGGAGCTGGG - Intergenic
926209946 2:10862375-10862397 CTCCACCTTTCCTAAGGGCCTGG + Intergenic
926245949 2:11122616-11122638 CTCCATCTTGCGTAGGAGCTGGG - Intergenic
926642434 2:15251897-15251919 CTCCATCTTGAATAGGAGCTGGG - Intronic
926766185 2:16324769-16324791 CTGCATCTTCCCTAATAGCCTGG + Intergenic
927574925 2:24192950-24192972 CTCCATCTTAAATAGGAGCTGGG - Intronic
928700823 2:33896757-33896779 CTCCCTCTTCCCTAGTAGCTAGG - Intergenic
929221391 2:39468206-39468228 CTCCATCTTGAATAGGAGCTGGG + Intergenic
929293063 2:40215279-40215301 CTTCAGCTTTCCTAGTAGCCGGG + Intronic
930157356 2:48119127-48119149 CTCCATCTTGAATAGGAGGCGGG + Intergenic
930414822 2:51078105-51078127 CTCCATCTTGAATAGGAGCTAGG + Intergenic
931143657 2:59491372-59491394 CTCCATCTTGGATAGGAGCTGGG - Intergenic
931349195 2:61472549-61472571 CTCCCACTTCCCTAGTAGCTGGG + Intergenic
931521015 2:63097634-63097656 CTCCATCTTGAATAGGAGCTGGG + Intergenic
931880118 2:66559910-66559932 CTTCAGCTTCCCTAGTAGCTGGG + Intronic
932143360 2:69298408-69298430 CTCCATGTGGCTTAGGAGCCTGG + Intergenic
932827424 2:74954711-74954733 CTCCATCTTGAATAGGAGCTGGG + Intergenic
933228772 2:79781453-79781475 CTCCATCTTGAATAGGAGCTGGG - Intronic
933427313 2:82129494-82129516 CTCCATCTTGAATAGGAGCTAGG + Intergenic
933427569 2:82132110-82132132 CTCCATCTTGAATAGGAGCTAGG + Intergenic
933581865 2:84136189-84136211 CAGTATCTTCCCTAGGAGACAGG + Intergenic
934029180 2:88026411-88026433 CTCCATCTTGAATAGGAGCTGGG + Intergenic
934697813 2:96412774-96412796 CTCCATCTTGACTAAGAGCTGGG + Intergenic
935095458 2:99940328-99940350 CTCCATCTTGAATAGGAGCTGGG + Intronic
935115008 2:100127821-100127843 CTCCATCTTGAATAGGAGCTGGG + Intronic
935203283 2:100876784-100876806 CTCTGCCTTCCCTAGGAGCTTGG - Intronic
936108698 2:109647582-109647604 CCCCAGCCTCCCTAGTAGCCGGG + Intergenic
937465716 2:122131522-122131544 CTGCATCTTACCTTGGGGCCAGG - Intergenic
937580621 2:123483556-123483578 CTCCTGCTTCCCCAGTAGCCGGG + Intergenic
937682413 2:124658056-124658078 CTCAATTGTCCCTAGGTGCCAGG - Intronic
937889994 2:126931359-126931381 CCTCACCTTCCCTAGGAGCAAGG - Intergenic
937943827 2:127312844-127312866 CCTCATCTTCCCTAGGAGCTGGG - Intronic
938232053 2:129669596-129669618 CTCAGTCTTCCCTAGGACCTGGG + Intergenic
938238990 2:129728514-129728536 CTTCATCTTCAATAGGAGCTGGG - Intergenic
938308349 2:130269126-130269148 CTCCATGCTCCCAGGGAGCCTGG + Intergenic
938446980 2:131387710-131387732 CTCCATGCTCCCAGGGAGCCTGG - Intergenic
938695477 2:133831470-133831492 CTCCATCTTTCCTAGGAAAATGG - Intergenic
939731704 2:145792913-145792935 CCCCTACTTCCCTGGGAGCCAGG - Intergenic
940209853 2:151245160-151245182 CTCCATCTTGAATAGGAGCTGGG - Intergenic
940509827 2:154599202-154599224 CCCCAGCTTCCCTAGTAGCTGGG - Intergenic
940654345 2:156470082-156470104 CTCCATCTTGAATAGGAGCTGGG - Intronic
940863370 2:158792393-158792415 CTCCATGTTGCCCAGGAGGCTGG + Intergenic
940982871 2:160023183-160023205 CTCCATCTTGTTTAGGAGCTGGG + Intronic
941706600 2:168664884-168664906 CTCCATCTTAAATAGGAGCTGGG - Intronic
942066309 2:172274920-172274942 CTCCATCTTTAATAGGAGCTGGG - Intergenic
942078846 2:172381825-172381847 CTCCATCTTGAATAGGAGCTGGG + Intergenic
942177909 2:173352852-173352874 CTCCATCTTGAATAGGAGCTGGG + Intergenic
942194624 2:173505234-173505256 CTCCATCTTGAATAGGAGCTGGG - Intergenic
942276129 2:174325401-174325423 CTCCAGCCTCCCTAGAAGCTGGG - Intergenic
942289759 2:174457194-174457216 CTTCAGCTTCCCAAGTAGCCGGG - Intronic
943466417 2:188234888-188234910 CTCCATCTTGAATAGGAGCTGGG + Intergenic
943466971 2:188240094-188240116 CTCCATCTTAAATAGGAGCTGGG + Intergenic
943819843 2:192306601-192306623 CCTCAGCCTCCCTAGGAGCCAGG - Intergenic
943895143 2:193347896-193347918 CTCCATCTTAAATAGGAGCTGGG - Intergenic
943991903 2:194706453-194706475 CTCCATCTTGAATAGGAGCTGGG - Intergenic
944502419 2:200375740-200375762 CTTCAGCTTCCCTAGTAGCTGGG + Intronic
946110311 2:217409138-217409160 CTCCATCTTGAATAGGAGCTGGG - Intronic
946172650 2:217904690-217904712 CTCTTTCTTCCCTAGGACCAAGG + Intronic
946733979 2:222735936-222735958 CACCAGGTTCCCGAGGAGCCAGG - Intergenic
946809984 2:223513350-223513372 CTCCATCTTCCATAGGCACCAGG - Intergenic
947016143 2:225622146-225622168 CTCCAGCTTCCCAAGTAGCTGGG + Intronic
947226276 2:227843403-227843425 CTCCAGCTTCCCAAGTAGCTGGG - Intergenic
947497354 2:230647608-230647630 CTCCGTCTTGATTAGGAGCCGGG + Intergenic
947543759 2:230996136-230996158 TGCCCTCTGCCCTAGGAGCCTGG - Exonic
948109548 2:235443738-235443760 CTCCATCTTGAATAGGAGCTGGG + Intergenic
948930644 2:241129695-241129717 CTCCAGCTGCCCTGGCAGCCAGG + Intronic
1169215264 20:3790034-3790056 CCCCAGCCTCCCTAGGAGCTAGG - Intronic
1169565836 20:6852660-6852682 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1170493306 20:16900007-16900029 GTACATCTTCCCTGGTAGCCAGG - Intergenic
1170635011 20:18096630-18096652 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1171304643 20:24094776-24094798 CTCCATCTCCCCAAGGAGTTTGG + Intergenic
1171411915 20:24953275-24953297 ATCCATCTCCCCGAGGAGGCTGG + Intronic
1171906104 20:30900467-30900489 CTCCTACTTCCAGAGGAGCCAGG + Intergenic
1172084947 20:32374121-32374143 TTCCAGCTTCCCTAGTAGCTGGG + Intronic
1172154897 20:32817564-32817586 CTCCATCCTCCCAAGTAGCTGGG + Intergenic
1172510593 20:35498113-35498135 CTCCCTTTCCCCTGGGAGCCAGG - Intronic
1172541258 20:35718865-35718887 CTACAGCTTCCCTAGCAGCTGGG - Intronic
1172588567 20:36101887-36101909 CCTCATCTTCCCTAGTAGCTGGG - Intronic
1173150807 20:40565304-40565326 CTCCCTCTCCCCTAGGGACCTGG - Intergenic
1173472066 20:43331955-43331977 CTCCCTCTTCCCTAGTAACAAGG - Intergenic
1173532671 20:43782458-43782480 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1173746702 20:45443012-45443034 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1174143363 20:48432703-48432725 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1174378815 20:50143453-50143475 CCTCAACTTCCCTAGGGGCCAGG - Intronic
1174525679 20:51168890-51168912 CTTCAGCTTCCCAAGAAGCCAGG + Intergenic
1174537161 20:51260108-51260130 CTCCACCTCCCCTAGGAATCTGG - Intergenic
1174547825 20:51339132-51339154 CTCCATCTTGAATAGGGGCCGGG - Intergenic
1174899135 20:54480175-54480197 CTCCATCTTGAATAGGAGCTGGG + Intronic
1175406927 20:58741052-58741074 CTCCATGAGCCCTGGGAGCCAGG + Intergenic
1175964371 20:62653138-62653160 CGCCTTCGTCCCAAGGAGCCTGG + Intronic
1177010346 21:15724696-15724718 CTCCCTTTTCCCTAAGAGCAAGG + Intergenic
1177070994 21:16507847-16507869 CTCCCTCATCCCCAGGATCCCGG - Intergenic
1178202075 21:30418740-30418762 CTCCATCTTGAATAGGAGCTGGG + Intronic
1178280335 21:31277061-31277083 CTCCATCTTAAATAGGAGCTGGG + Intronic
1178479151 21:32964066-32964088 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1179578708 21:42324112-42324134 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1179673861 21:42968554-42968576 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1179796061 21:43784415-43784437 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1180758545 22:18180883-18180905 CTCCATCTTCCCCAAAAGACAGG + Intergenic
1180768832 22:18364675-18364697 CTCCATCTTCCCCAAAAGACAGG + Intergenic
1180777480 22:18497720-18497742 CTCCATCTTCCCCAAAAGACAGG - Intergenic
1180810200 22:18755030-18755052 CTCCATCTTCCCCAAAAGACAGG - Intergenic
1180826707 22:18867899-18867921 CTCCATCTTCCCCAAAAGACAGG + Intergenic
1180898577 22:19354880-19354902 CTTCAGCTTCCCAAGGAGCTGGG + Intronic
1180943228 22:19674058-19674080 CTTCATCATCCCTAGTAGCTGGG + Intergenic
1181196344 22:21189282-21189304 CTCCATCTTCCCCAAAAGACAGG - Intergenic
1181213183 22:21303842-21303864 CTCCATCTTCCCCAAAAGACAGG + Intergenic
1181523833 22:23466829-23466851 CTCCATCTTCCCCAAAAGACAGG + Intergenic
1182139457 22:27940815-27940837 CTTCAGCTTCCCTCGTAGCCAGG + Intergenic
1182665790 22:31958919-31958941 CTCCATCCTCCCAAGCAGCTGGG - Intergenic
1182943931 22:34304771-34304793 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1183326203 22:37196060-37196082 CTCCATCTTGAGTAGGAGCTGGG - Intronic
1183366928 22:37411793-37411815 CTCCATCCCCTCCAGGAGCCTGG + Intronic
1183550337 22:38479113-38479135 CTCCAGCCTCCCTAGAAGCTGGG - Intronic
1183589579 22:38772044-38772066 CTCCATCTTGAATAGGAGCTGGG + Intronic
1183964936 22:41435896-41435918 CTCTTTCTTCCCTATGAGCTTGG + Exonic
1183966186 22:41444384-41444406 CTCCATGTTCCTCAGGAGCTAGG + Intronic
1184131184 22:42517633-42517655 CCTCAGCTTCCCTAGTAGCCAGG + Intronic
1184390689 22:44201467-44201489 CTCCACCTTCCCTGGAGGCCAGG + Intronic
1184709754 22:46242182-46242204 CACCACTTTTCCTAGGAGCCAGG - Exonic
1185050720 22:48552770-48552792 CCTCCTCTTCCCTGGGAGCCTGG - Intronic
1185141902 22:49107182-49107204 ATCCATCTTCCCAAGAAACCAGG + Intergenic
1203230454 22_KI270731v1_random:105559-105581 CTCCATCTTCCCCAAAAGACAGG + Intergenic
1203276850 22_KI270734v1_random:93809-93831 CTCCATCTTCCCCAAAAGACAGG + Intergenic
949098408 3:113921-113943 CTCCATCTTGAATAGGAGCTGGG + Intergenic
949699103 3:6735289-6735311 CCTCAGCTTCCCTAGGAGCTGGG - Intergenic
949966623 3:9362277-9362299 CTTCATCTTCCCAAGTAGCTAGG + Intronic
950018595 3:9770494-9770516 CTCCATCTTGCAGAGGAACCGGG - Intronic
950095379 3:10326409-10326431 CTCCATGTTCATTCGGAGCCAGG - Exonic
950762362 3:15243352-15243374 CTGCATCTTCATTTGGAGCCAGG - Intronic
950887874 3:16376495-16376517 CTCCATCTTCTCATGGAGGCTGG - Intronic
952911673 3:38194426-38194448 CTCCAGCCTCCCAAGTAGCCAGG - Intronic
953310834 3:41877440-41877462 CCCCAGCCTCCCAAGGAGCCAGG + Intronic
953351809 3:42221625-42221647 CTGCATGGTCCCTAGGAGCTGGG - Intronic
953416001 3:42718066-42718088 CTCCATCTTAAATAGGAGCTGGG + Intronic
953699104 3:45182349-45182371 CTTCAGCCTCCCTAGTAGCCAGG + Intergenic
954018762 3:47719584-47719606 CTCCATCCTTCCTAGTAGCTGGG - Intronic
954482821 3:50817321-50817343 CTCCATCTTAAATAGGAGCTGGG - Intronic
954938020 3:54344754-54344776 CTCCATCTTAATTAGGAGCTGGG + Intronic
955209136 3:56924878-56924900 CTCCATCTTGAATAGGAGCTGGG - Intronic
955380854 3:58436697-58436719 CTCCATCTTGAATAGGAGCTGGG - Intergenic
955381335 3:58440645-58440667 CTCCATCTTGAATAGGAGCTGGG - Intergenic
955693014 3:61608445-61608467 CTGCATCTTTCCTTGAAGCCTGG + Intronic
956325797 3:68051133-68051155 CTCCAACAACCCTACGAGCCAGG - Intronic
956690995 3:71877535-71877557 CTCCATCTTGAATAGGAGCTGGG - Intergenic
957218192 3:77348583-77348605 CTCCATCTTGAATAGGAGCTGGG - Intronic
959811913 3:110629495-110629517 CTCCATCTTAAATAGGAGCTGGG - Intergenic
959872674 3:111346419-111346441 CTCCATCTTCAATAGGGGCTGGG - Intronic
959989511 3:112615563-112615585 CTCCATCTTAAATAGGAGCTGGG + Intronic
960386264 3:117025510-117025532 CTCCATCTTAAATAGGAGCTGGG + Intronic
960387095 3:117033770-117033792 CTCCATCTTAAATAGGAGCTGGG + Intronic
960665021 3:120100189-120100211 CTCCATCTTAAACAGGAGCCGGG - Intergenic
960806709 3:121590553-121590575 CTCCATCTTCCGTCTGAGACTGG + Intergenic
961223626 3:125219591-125219613 CCCCAACTTCCCTGGGAGCCAGG - Intergenic
962098894 3:132321047-132321069 CTCCACCTTCCCTAGTAGCTAGG - Intronic
962463676 3:135637711-135637733 ATTCATCTCTCCTAGGAGCCAGG - Intergenic
962678153 3:137771168-137771190 CTCCCTCCTCCCTAGGTCCCCGG - Intergenic
962738053 3:138343462-138343484 CTCCAGCTTCATTAGGAGCTAGG - Intergenic
962748794 3:138417776-138417798 CTCCAGCTTCCCCAGAGGCCTGG + Intergenic
963128257 3:141834861-141834883 CTCCAGCCTCCCTAGTAGCTGGG + Intergenic
963818939 3:149866618-149866640 CTCCATCTTGAATAGGAGCTGGG - Intronic
964281925 3:155077099-155077121 CTCCATCTTGAATAGGGGCCGGG - Intronic
965587890 3:170335107-170335129 CTCCATCTTAAATAGGAGCTGGG - Intergenic
966034916 3:175399803-175399825 CTGCATCTTCAACAGGAGCCGGG - Intronic
966489330 3:180509731-180509753 CTCCATCTTGAATAGGAGCTGGG + Intergenic
967243561 3:187464878-187464900 CTCCATCTTGAATAGGAGCTGGG + Intergenic
967406937 3:189127035-189127057 CTGCATCTTCCCTTTGAGACAGG + Intronic
967960734 3:194921928-194921950 CTCCATCTTGAATAGGAGCTGGG + Intergenic
968127712 3:196172125-196172147 CTTCAGCTTCCCTAGTAGCTGGG - Intergenic
968601178 4:1510073-1510095 CTCCACCTTTCCTCTGAGCCCGG + Intergenic
969211270 4:5689336-5689358 CTCCTTCTGCCCTAGGTGTCTGG - Exonic
969634986 4:8363606-8363628 CTCCATCTTGAATAGGAGCTGGG + Intergenic
969639199 4:8386986-8387008 CTCCCTCCTCCCGAGGATCCAGG + Intronic
969696753 4:8739263-8739285 CAACATCTTCCCAGGGAGCCGGG + Intergenic
969906928 4:10405827-10405849 CTCCATCTTAAATAGGAGCTGGG - Intergenic
970031186 4:11676825-11676847 CTTCATCTTCCCAAGTAGCTGGG + Intergenic
970532320 4:16997262-16997284 CTCCATCTTGAATAGGAGCTGGG + Intergenic
970556080 4:17233629-17233651 CTCCAGCCTCCCTAGTAGCTTGG - Intergenic
971215786 4:24661229-24661251 CTCCATCTTGAATAGGAGCTGGG - Intergenic
972378789 4:38499538-38499560 TTCCAGCTTCCCTTGCAGCCAGG + Intergenic
972921369 4:43946417-43946439 CTCCATCTTGAATAGGAGCTGGG - Intergenic
973948923 4:55990612-55990634 CTTCAGCCTCCCTAGGAGCTAGG + Intronic
974354001 4:60788940-60788962 CTCCATCTTGACTAGGGGCTTGG + Intergenic
975043001 4:69768461-69768483 CTCCATCTTAAATAGGAGCTAGG + Intronic
975683229 4:76896822-76896844 CTCCAGCTGCCCTTGGAACCCGG - Exonic
975745164 4:77468171-77468193 CTCCATCTCCCCTACTAGCTTGG + Intergenic
976643177 4:87361042-87361064 CTCCATCTTAAATAGGAGCTGGG + Intronic
976644013 4:87368568-87368590 CTCCATCTTGAATAGGAGCTGGG + Intronic
976747184 4:88414914-88414936 CTCCATCTTGAATAGGAGCTGGG - Intronic
977100989 4:92814821-92814843 CACCATGTTCTATAGGAGCCAGG + Intronic
977244911 4:94619756-94619778 CTTCAACTTCCCTAGTAGCTGGG + Intronic
977592775 4:98844899-98844921 CTCCATCTTGAATAGGGGCCGGG - Intergenic
977673883 4:99726631-99726653 CTCCATCTTAAATAGGAGCTGGG - Intergenic
977674788 4:99734877-99734899 CTCCATCTTAAATAGGAGCTGGG - Intergenic
977926449 4:102705619-102705641 CCCCATCCTCCCCAGGAGCAGGG + Intronic
978589615 4:110310707-110310729 CTCCAACTGCCCCTGGAGCCAGG - Intergenic
979773842 4:124562822-124562844 CTCCATCTTTAATAGGAGCTGGG + Intergenic
980717165 4:136640894-136640916 CTCCATCTTGAATAGGAGCTGGG - Intergenic
981091774 4:140739750-140739772 CTTCAGCTTCCCTAGTAGCTGGG - Intronic
981362886 4:143867260-143867282 CTCCATCTTGGATAGGGGCCTGG - Intergenic
981373615 4:143988060-143988082 CTCCATCTTGGATAGGGGCCTGG - Intergenic
981382716 4:144091331-144091353 CTCCATCTTGGATAGGGGCCGGG - Intergenic
982236235 4:153253540-153253562 CTCCATCTTGAATAGGAGTCAGG + Intronic
982265851 4:153537790-153537812 CTCCATCTTAAATAGGAGCTGGG - Intronic
982459839 4:155655335-155655357 CCTCAGCCTCCCTAGGAGCCGGG - Intergenic
983862159 4:172720506-172720528 CTCCATCTTGAATAGGAGCTGGG - Intronic
984441203 4:179773413-179773435 CTCCATCTTGAATAGGAGCTGGG + Intergenic
986288833 5:6381410-6381432 CTCCATCTTGAATAGGAGCTGGG - Intergenic
987165849 5:15197077-15197099 CTCCATCTTAAATAGGAGCTGGG - Intergenic
987318508 5:16746415-16746437 CTCCATCTTGAATAGGAGCTGGG - Intronic
988131369 5:27110775-27110797 CTCCATCTTGAATAGGAGCTGGG - Intronic
988482636 5:31642466-31642488 CTCCTTCTTCCCTTGCAGCCTGG - Intronic
988974710 5:36503736-36503758 CTCCATCTTCCCCTGGAGGGTGG - Intergenic
990636626 5:57735353-57735375 CTCCATCTTGAATAGGAGCTGGG + Intergenic
990925037 5:61011285-61011307 CTCCAGCTTCCCTTGTAGCCAGG + Intronic
991432569 5:66563500-66563522 CTCCATCTTAAATAGGAGCTGGG + Intergenic
991676077 5:69091177-69091199 CTCCATCTTGAATAGGAGCTGGG - Intergenic
992154371 5:73940271-73940293 CTTGATTTTCCCTAGGAACCTGG + Intronic
992438867 5:76780852-76780874 CTCCATCTTCAGTAGGGGCTGGG + Intergenic
992519970 5:77540588-77540610 CCTCATCCTCCCTACGAGCCTGG - Intronic
992865846 5:80956492-80956514 CTCCATCTTAAATAGGAGCCGGG - Intergenic
992952791 5:81876960-81876982 CTCCAGCCTCCCTAGTAGCTGGG - Intergenic
993123904 5:83808492-83808514 CTTCATCTTCCCGAGTAGCTGGG + Intergenic
993328987 5:86573020-86573042 CTCCATCTTAAATAGGAGCTGGG + Intergenic
993829900 5:92742147-92742169 CTCCATCTTGAATAGGAGCTGGG - Intergenic
994097540 5:95860498-95860520 CACCATTTTCCCTGGGTGCCAGG - Intergenic
994185370 5:96809319-96809341 CTCCATCTTGAATAGGAGCTGGG - Intergenic
994532056 5:100984081-100984103 CTCCATCTTGAATAGGAGCTGGG - Intergenic
996293298 5:121880019-121880041 CTCCATCTTGAATAGGAGCTGGG - Intergenic
996351092 5:122542678-122542700 CTCCATCTTGAATAGGAGCTGGG + Intergenic
996925717 5:128823959-128823981 CTCCATCTTAAATAGGAGCTGGG + Intronic
997884094 5:137615358-137615380 CTCCAGCAACCCTGGGAGCCTGG + Intergenic
997977105 5:138446890-138446912 CACCCTCTTCCCAAGGAACCGGG - Exonic
998364582 5:141621048-141621070 CTTCATCTTCCCTGGAAGCAAGG + Exonic
998942468 5:147299479-147299501 CTCCATCTTAAATAGGAGCTGGG - Intronic
998982930 5:147724883-147724905 CTCCATCTTGAATAGGAGCTGGG + Intronic
1000035736 5:157446564-157446586 CTTCAGCCTCCCTAGGAGCTGGG - Intronic
1001041190 5:168336610-168336632 CTCCATCCTCCTCAGGACCCCGG + Intronic
1001411879 5:171518048-171518070 CTCCAGTCTCCCTTGGAGCCAGG - Intergenic
1001466591 5:171972383-171972405 CTTCAGCTTCCCTAGTAGCTGGG - Intronic
1001546092 5:172571186-172571208 CTCCTTCCTCCCTAGGAGCCAGG - Intergenic
1002056104 5:176598701-176598723 GTCCATCTTTCCCAGGAACCGGG + Exonic
1002594098 5:180311137-180311159 CTGGAGCTTCCCTGGGAGCCAGG - Intronic
1002778258 6:347149-347171 ATTCACCTTCACTAGGAGCCAGG - Intronic
1003066402 6:2906917-2906939 CTCAATGTTCGCTAGGATCCTGG + Intergenic
1003372496 6:5542243-5542265 CTCCATCTTGAGTAGGAGCTGGG - Intronic
1003897100 6:10617633-10617655 CTCCATCTTAAATAGGAGCTGGG - Intronic
1004389468 6:15197981-15198003 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1005019199 6:21401581-21401603 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1005325115 6:24692531-24692553 CCCCAGCTTCCCTCGGAGCTGGG + Intronic
1005449036 6:25955241-25955263 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1006830026 6:36963037-36963059 CTCCTTCTTCCCTAGCAACGGGG + Exonic
1007067294 6:39004123-39004145 CTTCAGCTTCCCAAGGAGCTGGG - Intronic
1007353508 6:41292874-41292896 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1007518566 6:42433086-42433108 CTCCCTTTCCTCTAGGAGCCTGG - Intronic
1007722959 6:43896548-43896570 CTCCATATTCCCGGGGAGACTGG - Intergenic
1008036120 6:46746853-46746875 CTTCAGCTTCCCTAGGTGTCTGG - Intergenic
1008684815 6:53913801-53913823 CTCCATCTCCCCTAGAAAACTGG + Intronic
1008911570 6:56739521-56739543 CTCCATCTTGAATAGGAGCTAGG + Intronic
1009565323 6:65304894-65304916 CTTCATCTTTCCCAGGATCCAGG - Intronic
1009569818 6:65370369-65370391 CTCCAGCTTCCCAAGTAGCCAGG + Intronic
1009604395 6:65848427-65848449 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1009939896 6:70279523-70279545 CTCCAGCTTCCCGAGTAGCTGGG - Intronic
1010070003 6:71732647-71732669 CCTCATCTTCCCTAGTAGCTGGG - Intergenic
1010424938 6:75719065-75719087 CTTCATCTTCCCGAGTAGCTGGG + Intergenic
1010445986 6:75949158-75949180 CTCCATCTTGAATAGGAGCTGGG + Intronic
1010486574 6:76421582-76421604 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1011469219 6:87690855-87690877 CTTCAGCTTCCCTAGTAGCTGGG - Intronic
1013580797 6:111532768-111532790 CTTCAGCCTCCCTAGTAGCCAGG + Intergenic
1014175627 6:118327992-118328014 CTGCATCTCTCCTGGGAGCCAGG - Intergenic
1015985061 6:138876207-138876229 CTCCCTCTTCCTTGGGAGCCAGG - Intronic
1016307704 6:142700729-142700751 CCCATTCTTCCCTAGGTGCCAGG + Intergenic
1016513944 6:144873016-144873038 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1017900058 6:158712030-158712052 CTCCATCTTGAATAGGAGCTGGG - Intronic
1018124129 6:160665484-160665506 CTCCAGCCTCCCTAGTAGCTGGG - Intergenic
1018357771 6:163035891-163035913 CTCCATCTTGAATAGGAGCTGGG - Intronic
1018478126 6:164163137-164163159 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1018767840 6:166947713-166947735 ATCCCTCTTCCTAAGGAGCCAGG + Intronic
1019007302 6:168809738-168809760 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1019638689 7:2090750-2090772 CCCCATCATCCCTTGGAGCCCGG + Intronic
1019822986 7:3259858-3259880 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1019946511 7:4333823-4333845 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1020355039 7:7266454-7266476 CTCCATCTTGCATAGGGGCTAGG + Intergenic
1021212810 7:17876462-17876484 CTTCAGCTTCCCTAGCAGCTGGG - Intronic
1021316394 7:19153176-19153198 CTCCATATTCCCTGGTACCCTGG + Intergenic
1021550476 7:21866140-21866162 CTCCATCTTGAATAGGAGCTGGG - Intronic
1022157941 7:27679057-27679079 CTCATTCTTCCCAAGGAGCATGG - Intergenic
1022258166 7:28679931-28679953 CTCCATCTCCCCAAAGAGCCAGG + Intronic
1022272714 7:28825987-28826009 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1022478604 7:30728164-30728186 CTCCATCTTGAATAGGAGCTCGG + Intronic
1024832059 7:53472520-53472542 CTCCATCTTGAATAGGAGCTAGG + Intergenic
1025111187 7:56217687-56217709 CTCCATCTTGAGTAGGAGCTGGG + Intergenic
1025769182 7:64488252-64488274 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1026119749 7:67526382-67526404 CTCCATCTTGAATAGGAGCTAGG + Intergenic
1026235744 7:68525587-68525609 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1026306715 7:69148783-69148805 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1026493740 7:70885132-70885154 CTCCATCTTGAATAGGGGCCGGG + Intergenic
1026522200 7:71127270-71127292 CTTCAGCTTCCCTAGTAGCTGGG + Intergenic
1026631052 7:72038537-72038559 CTCCATCTTGAATAGGAGCTGGG + Intronic
1026688479 7:72532855-72532877 CTGCATCCTCCCTAGTAGCTTGG + Intergenic
1026723714 7:72854746-72854768 CTGCATCCTCCCTAGTAGCTTGG + Intergenic
1026824514 7:73573128-73573150 CCCCACCTTCCCTAGGGACCTGG + Intronic
1027160972 7:75801888-75801910 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1027616440 7:80430335-80430357 CTCCATCTTGAATAGGAGCTGGG - Intronic
1027856111 7:83513882-83513904 CTCCATCTTGAATAGGAGCTAGG + Intronic
1028467901 7:91173341-91173363 CTCCAACCTCCCTAGAAGCTGGG - Intronic
1029105389 7:98170999-98171021 CCCCAGCTTCCCCAGGACCCTGG - Intronic
1030123121 7:106130048-106130070 CTCCATCTTCAATAGGAGCTGGG + Intergenic
1030224143 7:107130052-107130074 CTCCATCTTGAATAGGAGCTGGG - Intronic
1030316324 7:108118059-108118081 CTCCATCTTGAATAGGAGCTGGG - Intronic
1030601488 7:111597773-111597795 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1031173504 7:118320383-118320405 CTCCATCTTCAATAGGTGCTGGG - Intergenic
1031311660 7:120206896-120206918 CACCATCCTCCCTAGTAGCTGGG + Intergenic
1031582958 7:123499779-123499801 CTCCATCTTGAATAGGAGCTGGG + Intronic
1032123082 7:129170786-129170808 CTCCATCTTCAATAGGCGCTGGG - Intergenic
1032864177 7:135909450-135909472 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1032961506 7:137040843-137040865 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1033161510 7:139001214-139001236 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1033162090 7:139006687-139006709 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1033163938 7:139022428-139022450 CCTCAGCTTCCCTAGTAGCCGGG - Intergenic
1033577894 7:142703823-142703845 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1033613460 7:142987902-142987924 CACCACCTCCCCCAGGAGCCTGG - Intergenic
1033655418 7:143370387-143370409 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1034116256 7:148586397-148586419 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1034623489 7:152474643-152474665 CCTCATCCTCCCTAGGAGCTGGG + Intergenic
1034915705 7:155037005-155037027 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1035357620 7:158286068-158286090 CTCCATTTGCCCAGGGAGCCTGG - Intronic
1036101536 8:5792389-5792411 CTCCATCTTAATTAGGAGCAGGG + Intergenic
1037367650 8:18140034-18140056 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1037379868 8:18274070-18274092 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1037512749 8:19600196-19600218 CCTCATCTTCCCTAGTAGCTGGG + Intronic
1037623172 8:20584934-20584956 CTTCATCCTCCCTAGTAGCTGGG + Intergenic
1037884458 8:22589084-22589106 CTGCCCCTTCCCTCGGAGCCAGG - Intronic
1037909663 8:22736488-22736510 CTTCAGCCTCCCTAGTAGCCAGG - Intronic
1038548364 8:28443616-28443638 CTCCATCTTGAATAGGAGCTGGG + Intronic
1038645668 8:29359817-29359839 CTCCATCTTAACTCGGAGCTGGG + Intergenic
1039067717 8:33623542-33623564 CTCCATCTTGAATAGGAGCTAGG - Intergenic
1039077779 8:33708111-33708133 CCCCAGCTTCCCTAGTAGCTAGG - Intergenic
1039569654 8:38576575-38576597 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1039579554 8:38652949-38652971 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1039816378 8:41098237-41098259 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1039882095 8:41631341-41631363 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1039892915 8:41696728-41696750 CTCCCTCATCCCCAGCAGCCCGG - Exonic
1039963352 8:42266567-42266589 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1041712236 8:60905275-60905297 CTCCCTGATCCCTAAGAGCCAGG - Intergenic
1042095090 8:65206336-65206358 CTCCAGCTTCCCAAGTAGCTGGG - Intergenic
1042732859 8:71956216-71956238 CTCCATCTTGAATAGGAGCTGGG - Intronic
1043070662 8:75631719-75631741 CTCCATCTTACATAGGAACTGGG - Intergenic
1043839780 8:85089188-85089210 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1044439260 8:92204238-92204260 CTCCATCTTGAGTAGGAGCTGGG - Intergenic
1044984812 8:97748108-97748130 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1045122725 8:99055843-99055865 CCTCATCTTCCCTAGTAGCTGGG + Intronic
1045266654 8:100624197-100624219 CTTCAGCTTCCCCAGGAGCTGGG - Intronic
1045688500 8:104736434-104736456 CTCCATCTTAAATAGGAGCTGGG + Intronic
1045691431 8:104763736-104763758 CTCCATCTTGAATAGGAGCTGGG - Intronic
1046270009 8:111883113-111883135 CTCCATCTTGAATAGGAGCTAGG + Intergenic
1047003375 8:120595169-120595191 CTCCATCTTGAATAGGAGCTGGG + Intronic
1047112697 8:121808743-121808765 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1047290568 8:123526106-123526128 CCTCATCTTACCTAGGAGCAGGG + Intronic
1047354989 8:124111911-124111933 CTCCATCTTGAATAGGAGCTGGG - Intronic
1047390910 8:124450526-124450548 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1047512973 8:125529553-125529575 CTCCTTCTTCCCCAGGGGGCTGG - Intergenic
1047741018 8:127807127-127807149 CTCAATCTTACCTAGGAACGGGG - Intergenic
1048329461 8:133462131-133462153 GTCCATCTTTCCTACGAGCATGG - Intronic
1048331571 8:133474216-133474238 GTCCAACTCCCCTTGGAGCCTGG - Intronic
1048340901 8:133537685-133537707 ATCCATCTCCCCTGGGGGCCGGG + Intronic
1049036090 8:140077353-140077375 CTACATGTTCCCTAAGAGCAAGG - Intronic
1049298883 8:141859269-141859291 CTCCATCTTACCCAGAATCCTGG - Intergenic
1050141921 9:2525005-2525027 CTCCATCTTGAATAGGGGCCAGG + Intergenic
1051467372 9:17395836-17395858 CTCCATCTTAAATAGGAGCTGGG + Intronic
1052520839 9:29547120-29547142 CTCCATCTTAAGTAGGAGCTGGG + Intergenic
1052521528 9:29554073-29554095 CTCCATCTTAAGTAGGAGCTGGG + Intergenic
1052663932 9:31470317-31470339 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1052891379 9:33703643-33703665 CTCCATCTTAAGTAGGAGCTGGG + Intergenic
1053458837 9:38252756-38252778 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1053595933 9:39561801-39561823 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1053853900 9:42318442-42318464 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1054570326 9:66803214-66803236 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1055048437 9:71954839-71954861 CTCCATCTTGAATAGGAGCTGGG - Intronic
1055451746 9:76437192-76437214 CTCCATCTTGAATAGGAGCTGGG + Intronic
1055469158 9:76594355-76594377 CTCCATCTTGAATAGGAGCTAGG - Intergenic
1055567647 9:77585107-77585129 CTCCATCTTGAATAGGAGCTGGG - Intronic
1056054859 9:82811030-82811052 CTCCATCTTGATTAGGAGCTGGG + Intergenic
1056396195 9:86183567-86183589 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1056469846 9:86894724-86894746 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1056726687 9:89125503-89125525 CTCCATCTTGAATAGGAGCTGGG + Intronic
1057358584 9:94352527-94352549 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1057364092 9:94402215-94402237 CTCCATCTTGAATAGGAGCTGGG - Intronic
1057386811 9:94612206-94612228 CACCAGCTTCCCTTGAAGCCAGG + Intronic
1057580174 9:96280646-96280668 CTCCATCTTAAATAGGAGCTGGG + Intronic
1057588121 9:96347678-96347700 CTCCATCTTAAATAGGAGCTGGG + Intronic
1057649167 9:96905083-96905105 CTCCATCTTGAATAGGAGCTGGG + Intronic
1057659244 9:96985846-96985868 CTCCATCTTGAATAGGAGCTGGG + Intronic
1057809003 9:98243409-98243431 CTCCAGCCTCCCTAGTAGCTGGG + Intronic
1057988924 9:99747195-99747217 CTCCATCTTGAATAGGAGCAGGG + Intergenic
1059587435 9:115620942-115620964 CTGCATCTTCCCCAGGGGCAAGG - Intergenic
1060681850 9:125573140-125573162 CTCCATCTTAAATAGGAGCTGGG + Intronic
1060886705 9:127159655-127159677 CCCCATCTTCTCAGGGAGCCTGG + Intronic
1060889319 9:127178040-127178062 CTCCACCCTCCCCAGGACCCTGG - Intronic
1061301049 9:129705232-129705254 CTCCCTCTGCACTAGGAGCTGGG - Intronic
1061835407 9:133325577-133325599 CTCCAGCCTCCCTAGTAGCTGGG - Intergenic
1061894114 9:133638083-133638105 CTCTGGCTTCCCTAGCAGCCGGG - Intronic
1062069764 9:134549396-134549418 CTCCCGCTTCCCGAGGGGCCCGG - Intergenic
1062357313 9:136170948-136170970 ATCCATCTTCCCCACGGGCCTGG + Intergenic
1185539936 X:895058-895080 CCTCATCTTCCCTAGTAGCTAGG - Intergenic
1185750169 X:2604549-2604571 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1185841780 X:3398719-3398741 CTCCATCTTGAATAGGAGCTAGG + Intergenic
1185859787 X:3566872-3566894 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1185886651 X:3789318-3789340 CTCCATCTTAACTAGGAGCTGGG - Intergenic
1186670809 X:11765452-11765474 CTCCATCTTCCCTAGGAGCCAGG + Exonic
1186883516 X:13890014-13890036 CTCCATCTTAAATAGGAGCTGGG + Intronic
1187150311 X:16675150-16675172 CTCCATCCTCCCGAGTAGCTGGG - Intronic
1187182804 X:16958884-16958906 CCCCATCCTTCCTAGGATCCAGG - Intronic
1188126592 X:26375606-26375628 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1188336042 X:28934155-28934177 CTCCATTTTGACTAGGAGCTGGG - Intronic
1188867662 X:35333453-35333475 CTTCAGCCTCCCTAGTAGCCAGG + Intergenic
1189448364 X:41102906-41102928 CTTCAACTTCCCTAGTAGCTGGG + Intronic
1189480678 X:41390114-41390136 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1189781140 X:44515516-44515538 CTTCAGCTTCCCTAGTAGCTGGG - Intergenic
1189797033 X:44654868-44654890 CTCCAGCCTCCCTAGTAGCTGGG - Intergenic
1190476237 X:50830660-50830682 CTCCATTGTCCCTAGAAGCAGGG + Intergenic
1190815065 X:53922658-53922680 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1191636637 X:63384738-63384760 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1191851737 X:65590433-65590455 CTCAGTCTTCCTTAGGGGCCAGG + Intronic
1192172274 X:68864220-68864242 CTTCATCTGCCAGAGGAGCCAGG + Intergenic
1192331584 X:70179681-70179703 CTTCAGCTTCCCGAGTAGCCGGG + Intronic
1193883181 X:86951883-86951905 CTCCATCTTAAGTAGGAGCTGGG - Intergenic
1194139387 X:90191147-90191169 CTCCAGCTTCCCGAGTAGCTGGG + Intergenic
1194702241 X:97128502-97128524 CTCCATCTTAAATAGGAGCTGGG - Intronic
1194997860 X:100611316-100611338 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1196316281 X:114228449-114228471 CTCCTTGTTACCTAGGAGCAGGG + Intergenic
1196457017 X:115898194-115898216 GTCCATCTTCCCTAGGATGGAGG + Intergenic
1197359418 X:125481259-125481281 CTCCATTTAGCCTAGGAACCAGG + Intergenic
1197990807 X:132315014-132315036 CTCCATCTTCACTAGGAATGAGG - Intergenic
1198071337 X:133151498-133151520 CTACATATTCACTTGGAGCCAGG - Intergenic
1198454742 X:136805468-136805490 CTCCATCTTGAATAGGAGCAGGG + Intergenic
1198497949 X:137212795-137212817 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1200775613 Y:7167586-7167608 CTCCATCTTAACTAGGAGCTGGG + Intergenic
1200806934 Y:7443079-7443101 CTCCAGCCTCCCAAGTAGCCAGG - Intergenic