ID: 1186674313

View in Genome Browser
Species Human (GRCh38)
Location X:11799864-11799886
Sequence TCTTCTCCATGTAGTCCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186674313_1186674319 16 Left 1186674313 X:11799864-11799886 CCATGAGGACTACATGGAGAAGA No data
Right 1186674319 X:11799903-11799925 AGTAGCTGTATGAGTGAGGTTGG No data
1186674313_1186674317 12 Left 1186674313 X:11799864-11799886 CCATGAGGACTACATGGAGAAGA No data
Right 1186674317 X:11799899-11799921 TGCCAGTAGCTGTATGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186674313 Original CRISPR TCTTCTCCATGTAGTCCTCA TGG (reversed) Intergenic