ID: 1186680694

View in Genome Browser
Species Human (GRCh38)
Location X:11870589-11870611
Sequence GGGCACTATGAAGACCCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186680694_1186680702 22 Left 1186680694 X:11870589-11870611 CCTTTTGGGTCTTCATAGTGCCC No data
Right 1186680702 X:11870634-11870656 TGCAAGAGCTGTGTCTCCGTTGG No data
1186680694_1186680703 23 Left 1186680694 X:11870589-11870611 CCTTTTGGGTCTTCATAGTGCCC No data
Right 1186680703 X:11870635-11870657 GCAAGAGCTGTGTCTCCGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186680694 Original CRISPR GGGCACTATGAAGACCCAAA AGG (reversed) Intergenic
No off target data available for this crispr