ID: 1186687762

View in Genome Browser
Species Human (GRCh38)
Location X:11943471-11943493
Sequence CATGGGATAATGCAGCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186687762_1186687772 28 Left 1186687762 X:11943471-11943493 CCTTCAAGCTGCATTATCCCATG No data
Right 1186687772 X:11943522-11943544 GTATGAAAGAGAAAGCATGAGGG No data
1186687762_1186687767 -6 Left 1186687762 X:11943471-11943493 CCTTCAAGCTGCATTATCCCATG No data
Right 1186687767 X:11943488-11943510 CCCATGGCGGAAGAGCAGAAGGG No data
1186687762_1186687769 -1 Left 1186687762 X:11943471-11943493 CCTTCAAGCTGCATTATCCCATG No data
Right 1186687769 X:11943493-11943515 GGCGGAAGAGCAGAAGGGCAAGG No data
1186687762_1186687771 27 Left 1186687762 X:11943471-11943493 CCTTCAAGCTGCATTATCCCATG No data
Right 1186687771 X:11943521-11943543 TGTATGAAAGAGAAAGCATGAGG No data
1186687762_1186687765 -7 Left 1186687762 X:11943471-11943493 CCTTCAAGCTGCATTATCCCATG No data
Right 1186687765 X:11943487-11943509 TCCCATGGCGGAAGAGCAGAAGG No data
1186687762_1186687773 29 Left 1186687762 X:11943471-11943493 CCTTCAAGCTGCATTATCCCATG No data
Right 1186687773 X:11943523-11943545 TATGAAAGAGAAAGCATGAGGGG No data
1186687762_1186687770 0 Left 1186687762 X:11943471-11943493 CCTTCAAGCTGCATTATCCCATG No data
Right 1186687770 X:11943494-11943516 GCGGAAGAGCAGAAGGGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186687762 Original CRISPR CATGGGATAATGCAGCTTGA AGG (reversed) Intergenic
No off target data available for this crispr