ID: 1186687767

View in Genome Browser
Species Human (GRCh38)
Location X:11943488-11943510
Sequence CCCATGGCGGAAGAGCAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186687762_1186687767 -6 Left 1186687762 X:11943471-11943493 CCTTCAAGCTGCATTATCCCATG No data
Right 1186687767 X:11943488-11943510 CCCATGGCGGAAGAGCAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186687767 Original CRISPR CCCATGGCGGAAGAGCAGAA GGG Intergenic
No off target data available for this crispr