ID: 1186687770

View in Genome Browser
Species Human (GRCh38)
Location X:11943494-11943516
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186687762_1186687770 0 Left 1186687762 X:11943471-11943493 CCTTCAAGCTGCATTATCCCATG No data
Right 1186687770 X:11943494-11943516 GCGGAAGAGCAGAAGGGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186687770 Original CRISPR GCGGAAGAGCAGAAGGGCAA GGG Intergenic
No off target data available for this crispr