ID: 1186687771

View in Genome Browser
Species Human (GRCh38)
Location X:11943521-11943543
Sequence TGTATGAAAGAGAAAGCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186687768_1186687771 9 Left 1186687768 X:11943489-11943511 CCATGGCGGAAGAGCAGAAGGGC No data
Right 1186687771 X:11943521-11943543 TGTATGAAAGAGAAAGCATGAGG No data
1186687762_1186687771 27 Left 1186687762 X:11943471-11943493 CCTTCAAGCTGCATTATCCCATG No data
Right 1186687771 X:11943521-11943543 TGTATGAAAGAGAAAGCATGAGG No data
1186687766_1186687771 10 Left 1186687766 X:11943488-11943510 CCCATGGCGGAAGAGCAGAAGGG No data
Right 1186687771 X:11943521-11943543 TGTATGAAAGAGAAAGCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186687771 Original CRISPR TGTATGAAAGAGAAAGCATG AGG Intergenic
No off target data available for this crispr