ID: 1186687773

View in Genome Browser
Species Human (GRCh38)
Location X:11943523-11943545
Sequence TATGAAAGAGAAAGCATGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186687768_1186687773 11 Left 1186687768 X:11943489-11943511 CCATGGCGGAAGAGCAGAAGGGC No data
Right 1186687773 X:11943523-11943545 TATGAAAGAGAAAGCATGAGGGG No data
1186687762_1186687773 29 Left 1186687762 X:11943471-11943493 CCTTCAAGCTGCATTATCCCATG No data
Right 1186687773 X:11943523-11943545 TATGAAAGAGAAAGCATGAGGGG No data
1186687766_1186687773 12 Left 1186687766 X:11943488-11943510 CCCATGGCGGAAGAGCAGAAGGG No data
Right 1186687773 X:11943523-11943545 TATGAAAGAGAAAGCATGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186687773 Original CRISPR TATGAAAGAGAAAGCATGAG GGG Intergenic
No off target data available for this crispr