ID: 1186687895

View in Genome Browser
Species Human (GRCh38)
Location X:11944720-11944742
Sequence CTCGAGCAATGGTGGCAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186687888_1186687895 -7 Left 1186687888 X:11944704-11944726 CCTCGCACCCCGAGACCTCGAGC No data
Right 1186687895 X:11944720-11944742 CTCGAGCAATGGTGGCAAATAGG No data
1186687887_1186687895 14 Left 1186687887 X:11944683-11944705 CCACTGAGAGCAGTTGCTAGTCC No data
Right 1186687895 X:11944720-11944742 CTCGAGCAATGGTGGCAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186687895 Original CRISPR CTCGAGCAATGGTGGCAAAT AGG Intergenic
No off target data available for this crispr